Dasypus_novemcinctus Locus Mono:25:SNORA5
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:25:SNORA5
Dasypus_novemcinctus
Mono:25:SNORA5
scaffold_9871
SNORA5
1001..1123
2123
TTTTCTTTTCACATTTACTAGGCCGAGTTTAGGAAGAAAAAAATCATTATTCTATCTAA
TGACAGGCATAGAAACAAAGTCTTCTTTCTGAAAATATCGCGTCATGAATAGAATATTCG
TAAGAATACATGGCATGAAACGTAAAAATAATCTTTAAAAAATTGTCCTTTTAATCCTGT
ATAGGAAATATTAAAATTATATTAATTTAGAGATATTTCAAGAAAATATACATGTTAAAT
ACATATAACCTATACAGACTATATCTAGCCTTAGAAAGAAATGTAAATTCATATATTTTT
ACGGGGGTCTTGTTCATTTCTCGCCTAGATTCTGTTTGAACACTGGTAATTGCTTCCTAA
GTGTACAACACTGTTGTAGGCATTTGAGGAGAAATTTTAAAGTACAGCATGCGTGATTAG
GAAGATGAAATAAGTTGATCGTAGAAGTTCAATGTACATTAGGAAGATGAGTTGTTCTGG
AAAGAGCTCTAGATGAGCCTGATTCTTGTCTCATATCTGGTCATTTCATATCTGTGGCCA
TAGGCGAGTTGTATAGCATCATTAGGTTAGGTTTCCTTCTATTGNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNTTCAGAATTTTAATTTTTAAGATAATAATTGTAGCTACCAATATAGTGAAAGTA
TTTGCAGTGTGCCCCACTGACTCTAGTAGAATTACTCTTACTATATGTCAGTTTCTGGGA
AGTATCAAACATTAAAAAATGATTCTCTATACAAAAGATTTTAGAATATTCAACTTTATT
ATTAAATTTCCTTTCCCCATCTTCTTATTCTTAATACTCCAAAACTTACCATTTCTATTA
TTGAAATAGCTCTTAGAATAAATTGCTATTAAATTACATTTTGAGAAAAGTTCATAGCAT
TTTAGCTGGGGCTGCCACAGATGACTGCCATAGCAAACTCTGCAGATTATGTGTCCTAAG
TCCTGTATCCTGGGATCTGGGAATAAGTTTGGCTGCAGACATTGTGTGCTGCATGTACAG
GAGTCATTGGGGGTGGGGAGAAGAGACAGGTCCTGTACAGTTGGGCCTGTGTTTAGTGAG
CTCAGGCCCAGGTATTGTCTCACAGAGGGCTACCCAGGATGGGACCCTTGCCCTACAGCT
CTTCCCTGGCTTCCCAGACTGTCCTGCTGACCCCCATGCGGCTGTGGTTGACAGTACTTG
GAGCTTGTGGAGCACTTTCGCCCTGATGAATTGCTAAAGCCGTTGCCGACTCCAATCGCA
CTTAATCAGTAGTCAGTGCCCTTGCTGCAGGTCACCTACCACCTTGTCCAGAAGCCCTTT
ATCTTGATGAAAGGTGACCTCTTGGACCTGACCTATGCCTATGGCAGACTCAATTTCTAC
CAGACCCAGGTGTTCCAGTACCTGGCAGCCAATTTGCTGTCCCATGTGTCCAGCCTGACA
CCCAGAGCGATCACCCACTGCACCAAGTCCTTCATTTTCCTCAAGTGGCTGAACCTGCCT
TTGTTTGAGGCCGTTGCCCAGCACATCCTGAACAAAGCCAAGAACAGCCCCATCACATCC
AACGCAACATGGTCCTGGCTTTTGTTCCTCTGAACTTCCATCTGGAACAAGATCAGTTCT
TCACTGGGTGCTCAGGAAGCTGGCCCAGAGCAAGCAGGCCTGACCCCAGCTCTCCAGGTG
GATGTGGTGTGGTCCCCATGTGTGCTGCAGCAGGTGAGGAGGCACAGCTACTAGCTGTCC
TCTGCCCCAAGTTTCACACCGTTTTTAGGTGACCAGTCTCTGAAGGAGCTGCTCCACCTC
ACCACCGCCACCCACCTGGAACACCCCAAATATACACACCTCCTCTTGCCAGACTCAGCC
TTGGTCCCCAGACTAACAGTACTTGAGAAGAAAGAGATCCCCCTGAAGAAGGAGCTTCAG
GGATCTCTGAAGGGGCTTCTGGGAAATGCCAACAAGGGCTACTTCACATTGGCATACAGT
ACAGCTGAGTTCTGGATGCTGAGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved