Dasypus_novemcinctus Locus Poly:20:SNORD58
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Poly:20:SNORD58
Dasypus_novemcinctus
Poly:20:SNORD58
GeneScaffold_3879
SNORD58, SNORD58, SNORD58
1001..1065, 1411..1475, 3895..3959
4959
CGCCGGTCCTCCCACATCAACATCCCCTTTCATCAGTGAGGCACATTCATTGCATTCGC
AAGCCTGTTTTTAATGGATTGATATTTATAACCCATGATTTATTTTGCGACACAAAAGGG
GAGCATTTTGAGACAATCTCTAAGGACATGATTCGTTTTTACACCTTCTTAAAACTTACT
CCTCACCCCCTATCTTCTGCGTCTTAGCCCCTCCTCAAATCTCGTTTCTTTAACAGAAAT
CTCGCGAGAGGTCGCGTTCTCATGAATTCTCCCAGGGGCCTCTGCTCTTCCTCTTCCCCA
AAGTCGCCTGAGGTGAGTCTCTTCGGTGTTGCGCTCTTCGTACTCAATCCACCGGCTATC
GCCGCCATCCTGCTCTCCCCGCCGCCGGTCTCAAGGCTTCTGGGAGGAGAACTCCCAGGA
CTAGTGATTCTTTGCTGGAGGCAGGGTCCCCCGTGATAGGGGACAAGGCGAAACTCCCGG
CTTGTCGCGATGGGGCTGTCGCGCGTCTGCGGCCCCGGAGGGGCGCGGTGGACGGCAGTG
CGGGTGGCAGGGCCCGTCCTCCCGCGGGGATACATACGGGGGTGGCCTGTGGCCGGTGCC
TCCAACCTCGGAGGCCCGGCGTGTCGCGGTGAGCGATGGCCGCGTACGTGGCGCGTTGCT
GCAACGACAGACTGTGGGAGTAAGAGTAAGGTCGTGTGGAAGCTTCTCATTTGAAAGAAT
GTTTCAAATTCGGTGGTGCTTAAGGTGGGCAATAGCGCGAACGTCTTTGTGGAAAACAGT
GCATTCCTTGGCGAAGCTGTGGGAATCGAGGGGGTTTCTGTAGAGGGCTTAGTACACTTC
TGCTGTGCTGAGGAACGGGCCAGGTCATTTACGCCTGAAATAGAAACAGAGAGTTCAGTT
TCCTTCCAAAGAAAAGGGGTCGCTCATTTTGTGTCAACACTGCTATAGCCATTAGTAGTT
GGAAAGAGAAGAAAGAAAGCACTGGATGTTGAAAAGGCTGGCTGCAGTGATGGAATTTCT
TGGACACCTTTGGATTACTCATGAAAAAAACTAGTATCTGAGGAACTGTTCACAGTAGTA
AATACTAAAACTGCATTCCTTTTTGCATGTAGGTATTCTTGACAGGATTGTGCTGTGTTC
CCTTCCAGGTGATCTCTGAAAATGGTTCGCTATTCCCTGGACCCAGAAAACCCCACAAAA
TGTAAGTGAACAGAAGATAAATATCTCCTGTTTGGGGGTAAGGAACAGTAATGAGATACC
ACAATTAACCAAACCTTTTTATTTTGCAGCATGCAAATCAAGAGGTTCAAATCTTCGTGT
TCACTTTAAGGTATATGAATCTTAGTTACATTCTAAGAGAGTTGTTCCCAAATGTTCCAG
TGTCTACCTCTAAACTGTTCTGAAAAGGTAGCTGCAGTGATGACTTTCTTAGGACACCTT
TGGATTTACCATGAAAATGAACAAGTTCTGAGCAGTCACCTTTAGAACTTTAATCATTGT
GGTATAATGAACACTTTTATTTAGGATTTGTGGGATTGAGTAAAACTGCAAGAGAACAAC
TTGAGAACACCTGTAGGTGAAGATGGGGCACATAATTGTATTTACAAGTTGGTGGTGTCA
AAACTGTTCATAGTCGGGAAACGGACTTGGCCCAGTGGTTAGGGCATCCATCTACCACAT
GGGAGGTCCGCGGTTCAAACCCCGGGCCTCCTTGACCCGTGTGGAGCTGGCCCATGTGCA
GTGCTGATGTGCGCAAGGAGTGCCGCCCCACACGAGTGTCCTCCAGAGTGTCCTCCACGT
AGGGGAGCCCCCATGCACAAGGAGAGCCGCCCAGCGCAAAAGAAGGTGCAGCCTGCCCAG
GAATGGCGCCGCCCACACTTCCGGTGCCACTGACAACAACAGAAGCGGACAAAGAAACAA
GACGCAGCAAATAGACACAGAGAACAGACAACCGGGGGAGGTGGGGAATTAAATAAATAA
ATCTTTTTTTTTTTTTTTTTAATGTTCATAGTGAATAAATGGGGGGTTTAGAACTAATTT
TTTCTTAGCTTCAATGAGTCTGTCTCTTAATCTCATGTTTTTCCATATTACTCACTCGCA
GGATAGAAAGCTTTTAATTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGGTTTGGG
TAGTAAATTAAAGGAAGGACATTTAGAGTAAAGGTAAAGGCACACACCAGTTGAACAAAT
AAGTGATTTGAAGTCTTACAAATACATTTTGGAAACTGTTTCATGAAGGCAGGAATTTGG
GGTGTGGTTGGGAAATTAGTATTTTCTAGTGATATGGTTTGTGTGATGATCGGATAATTA
AAAGATGGTTATTTGGTTTTGTTTTTGTTCCCTGTCCTCTGACCCCAGGGTTTAGATGTA
GATTCGCTGGTCATTGAGCACATCCAGGTGAACAAAGCCCCCAAGATGCGCAGGCGTACT
TACAGAGCCCATGGTCGGATTAACCCATACATGAGCTCCCCCTGCCACATTGAGATGATC
CTTACTGAAAAAGAACAAATTGTTCCTAAACCAGAAGAGGAGGTTGCACAGAAGAAAAAG
GTAAGTTACTTAATAGTTACTTGGTTTTGATTGTAATAACTAGGAAGATTTGTGGTTGCT
ATGATGACTATCTTAGGACACCTTTGGAATAACCATGAAAGAAAATTTTTTCTGAGCAAC
CTCTTTGATCCCTTTTAATGGATCTCCCCACTCAGCCCCCCAAATCTAGTGAGTTTGAGT
TTACTTAAGCATTATCTTCCTTCCTGGCTGCCAGACTTAATTTCAGGGCCTTATGAAGTA
CGCTCCCTGCCTCTAGTCTTCAGTGTGAACAACATTCATGTCTTGAAGCCACTCTTCATT
TCTCCCCCTCCCGCCAATCCCCATATCACCCAATTCTCTATGCTGAAAGACTTGATATTG
AATGTTCTTGGTCGTCCAAAGATTCACTGAGTTTCCTGCCGCCTCCTCTTAAGATGTATG
GGTTTTTCCAGAAAACTTAATATTCCCTGCCACAGTCTGGGTTTGGAAAAAGCAAGCATC
TATGAATGGCCAAATCCCTTTTCTCTCCATGCCGAATAAATGATTTGCCATCTCAAATTT
TGTTTGAATGTTTAAATAGTCCTTTTATTTTTCTTCCCTTAGATATCCCAGAAGAAACTG
AAGAAACAAAAACTTATGGCTCGGGAATAACTTCAGCACACAATAAATGCAAATAAAAGT
TAAAGCAGAGTGTTGGTTTTATTAGTAACTGTATTTCAAGTGTCATTACAAAATAGATCA
AACTAGTTTTCTCATTATGATTAGAATTCCAGATTGTTTTGTTTACACTGTCATTTTTGG
TTCATAAGCATGCTGTTTTGAATCGTTATTTTCAAAGTTTATATAAATGGGGTCATGATC
CTTTTGTGCCTTAGCAATCAGTTGATTTACATTTTTTTAGCTATTCCAAATAATGCTTTG
TGAACCTTTGTGTGGGAGTTTTTGTGAGAATATTCATTTCTCTTGGGTATGTACACTGGA
GTGGTTATTGCTGGAACATAGAAGAACAGTTTGAGTAACTGTCAAGCTCTACCAGAGTAG
CTACATCGTCTTATATTCGCACAAGTTATAAGTGAAGGTTCCAATTTCCACATCATGGGC
AACACCTCTTGGTTGTACTAATCCTAGTGAGTGTTAAGTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved