Dasypus_novemcinctus Locus Mono:0:SNORA38
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:0:SNORA38
Dasypus_novemcinctus
Mono:0:SNORA38
scaffold_4084
SNORA38
1001..1132
2132
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNATTTTTAGTCTAATTATTCCACGGTAATAGCCCTTGACCCTTATTCACCAAA
AGACAGAGAATTCCACTTTCAGGAACAAACTTGAAAAAAAGTGTACTTGGAAAAGCAACA
CACTAATCATATGTAAAGCCTCCCTTTAAGAAAACATCTAACCCTCCTACAAAGGCGTGT
CTGTGATCTCCTGTCCTTGGACACGTAAGAATTGGAGGCATAGAGATGTGGACTTGGAGA
AGTCTGGAGCCAGCTTGCTCCCTGCAGGCTCAAGAACACCCTTTCCCACACAGAAAAAAA
CAAAAAAAGAAAAGAAAACATCCAAAAGATGAATAATTTAGACTTACCACAAGAAAATGA
TTCAGTGCCATATTATTTTGGTAGGAGAATCAATTTCTGAATGGCTCTGAGTATATGTGA
CAAAAATCCCCCAAAACACTGGAGATTTCCATGATGCCTTGGAAACACATCTACAGCTTT
TTAGTCTCTCTAAATCTACCAAAAGTAGGGTGCCTTGAAATCATGCTGGTCTGGCTTTAA
ATTAGGGCCTTTTATAGGTGAGGACCCAACTCATCATGGGACTTCTTTCTGCCCCTTGCC
ACCTCCCCAAGGTTTTGAAGGCTACTTTATTCATGTCTCTTTGCTCAGGCTTCTGTCTCC
TTGAACTCTCTCACCCAACCCATTTCTATCCAAATTGTGTAGTAAATTCTTAATCATCTT
TCAAAGCCTGGTAAAAATATTTCCTGCTCTTGGTAGATTCCCAGCTCCCTCAAACTCATC
CCAAACCTTTCCTCTTTCCTCTCCCAAAAGGACAAGCTCTTTGCAACACTCTATTAAAGC
TCTAATGCCAACTCATCAGGGCTACTGGTTTACATGTCTGCCTCTCCTGCTGGACCACTC
AGAGCTTGTGACAACATCTCTTTTTCCCTGTTGAACCTCTATCTCTTCTTCACCCAGTAC
CTAATGCACAATAGGTGCCTGATTCCAATTTGTTTATCTCAGTATCTGTTCCCTTTCTAA
AACCCTCCACTTGTCTAGGGTATTGTTAAGGCTATGAACATTTCTATTCAGGAACCCACC
AGAACAAAATCTATGTTCTCTTAAAACTCTGACTTTGCCCTTCTCTGTTTTAAAAGAAAA
TGGTTCAGTCAGAAACTTTCAAAACAAGTCTTTGTTCTCTTCTGTATCCTAGAAGTAATT
TTAGATCCAAATGCCATCTGATCAATCAATGCGTTATGCATCTGTAAAGGACAATTCTGA
AATTGGCTTGAGTGCCTATAGGAAAGAAGGTCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved