Dasypus_novemcinctus Locus Mono:394:SNORA8
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:394:SNORA8
Dasypus_novemcinctus
Mono:394:SNORA8
GeneScaffold_4826
SNORA8
1001..1138
2138
ACAATTGGGAACCACTGGGAAACCATTGGTTGAAAAGGCAACTAGAGGGAAAGATAAAT
GGAAAAATAAAAGCAGCTATTTTTACAGCCTGTGAGTCCAAGGTTTTTAAAAATATATTC
TGTTATTTAATCATAACATTACCAATTAGATATTACCAATTTATAGATGAAGCAACTGAG
TTCTTGCTCGACATAAAAGTCAACACTTCTTTCACTATACTATCGTATTTCTCAGTAAAA
ACAAAAGAAAATAGCAATATGGGAATAAGAAGGGTGGGGAAGGCTTCTCTTCTGGGAGAA
AAACTAAGGTTGAGAAACTGTTTAGTTAACGACCCATGCATCTAAAGTGGGAGTTGGCAA
ACTTTTCCTGTAAAAGAACAAATAGTAAATATTTTCAGCTTTTTCCAGCTTTGCATACTA
TATACTGTCTCTGTCACAACTATTCAACTCTGCTGTTACAAAACAAAAAGTCTGATAATA
CATAAATGAATTGGCTATGTACCAATAAAACTTTATTTACAAAAACAGAATGCAAGTAGG
ATTTGGTCCTCTCACCTTAGTTTGCCAATCCATGTAGTAAAGGGAAACATTCAGACTCCT
TAAACTGGTATTCTAAAGCCTTTCACAATCATCTCAAATCTACTTTCCATTTAGTGATAT
TAAAGGCCTAAGGCAAGTCAAATCTTTCTGGGGACAAAGAATGGTTTTTGGAGTTAAAAA
GAATGAAAGGCATAATCACTTCCAGGAAGAAGCTTTATAATGTTAGATCTTCTCATGAAT
GATCCACTCTGCCAAGTCAGCTTCCATTCTAATCAGTTGTCTTTACTGTTTTAGAGATAT
TCCTATGCTTTCCAATATTCATACTTTTACATATAACATCTGTGTTTCCCTTATCTCCTC
TATTAGTAAATATATCAAAACCTCCCAAATTACTTCTCTGCGACCAAATGTTCCTCTCTA
AAGCAACCGCTTTAGGGCCATATAATATATAAGTGATATATTGCACTGCATGGTATCTGC
ACTCAGCATTTTTTCCTGCTGGGGTGTTCAAAAGTCAGTGCTATAGAAATTCAGTATCGG
GCATTGTTGGTTTTCTTGGCTTTGTGCACGTTAAACCTAGTATTTCTATTGATATGGTAT
TTCCATGGTTTTTTCAATACTGTCCAGATTGGTGTAATCATCAATAAGAACAAATTCTTA
GGTTTTTCCAGGTTGTCTGAAATTTTGAACCATGCAGATCCACCAATTCTAATTTATAAG
AACCTAAAGTGAATAACTTGAAGAAATTAGGATCCAAGAATTCTAGTAAACAGGCGGGGA
GTTTCTGAAGCATACATCAGTTTGTCCACACACAAGTGGAGATGAAAAGAAGCCCATCTA
AAAGAATTTTTACAAGTCTGACTGGAAACAGGTGTGGATTCTTTTTAAAGGGCTATCTGG
AAGATAAATCTTGTTTCAAGCTTCAGAGGAACTAATTTAACTTCGATAATTAAACAGTGG
AATAATCACGTTGAATTCCGTAAATAAAAAACTTATTAACTTATAAAAAAATAAATGATT
ACAGCACTCACTTAGCAGCTAGTCACATACTGTCGTGTGACATTTCTTATATTTCAGTAC
TGAGATACTGTATTTAACAAGTATTTCTAACTCAAGGACAGGTACACTATCTACTATCCT
TGTATTTAATAAAATGATGTCTATTAGCATCTCTCAATGCTGCAAGTGCTAATTGTGTCA
TTAAATGTCTATAACTGACAATATTGTTCTTAAAAACAAGACAATTATGCCATCAAAATA
ACTGAGCTAATGTTAGAAAAGTCCCTCAAGAAGAATAGTTAAAAATTAAGATAAAACAAA
AACCCATATTCTATTTTCTAACAAAATACTAACATGGAGACAAACAACAAGTAACCCAAA
TATCATAAGAAATTTCGATCTGTGATGATCCTTTAATCTGGATTTTAGAGCTCAAAAGGG
AAAAAATTAATATTTTCCAAGAAATGTTATGGCTTTTAACATAAAATTAAAACTCTTCCT
GTAGCAAAGGATTCTAAACCATTTACACAGAGAAGATGCTGATGGAAAGAAATGAGTACT
GGTCTTGTTCCATAACATGAAATGTGTCTCTAGTAACTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved