Dasypus_novemcinctus Locus Mono:391:SNORD95
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:391:SNORD95
Dasypus_novemcinctus
Mono:391:SNORD95
GeneScaffold_4182
SNORD95
1001..1067
2067
CTTGAGGGAAGAACCGCCCCCTGTGCATGAAAAGCTGCTAGGGTCTGACAGTTTACCTT
AGCACGATTTTTAAAGTTTATAAAGTTTCTTTTTTAATGCAGTGTTTTTCATATTGCCCA
TCCGTACTCACACTTGGCGACAGCGGAACTAAAGCCCCTCCCCGCTGCCGTCTCAGCCAC
CAAACGGAAAGGGCGGAGCTCGCGCGGTGCCACGTAAGGGGCAGAGAAGGCGACCTTTAT
TGGAATGTGCCGTACATTTCAGCACTTCCGCTTCTGAGACATCATGCCCCGGTGAGCGTT
TGAGGAGCCTTTTTAAACACCCAGTCGTATTGGTTTCAGAAAAGATTTGTATGGCGCTGT
CGAGTTATGTTACGTGGCGGAGGGAACCATGATGTAGTGTGATTTCACCTCGCCCTTTGA
GATACACGGCGCCGCCATCTTTAGCAGAAGCGACACTTGGGGGCCGCCATTTGCGTGAAC
GGGAGGGTATTTCCGGTTCCGGCGGTGGGCCGCTCGGTCTTTTTCACCTCGGGGCCGCGG
CGGGAGAGGTTGTGGCTATCGGTTCTCTGAGCTATCTGGTGCCATCCTCGTCGCTGCGGC
GACTCCCACACCCGCCGCTGCCATGACTGAGCAGATGACCCTCCGTGGCACCCTCAAGGG
CCACAATGGCTGGGTGACCCAGATCGCTACCACTCCGCAGTTCCCGGATATGATACTGTC
GGCTTCGCGAGGTATGGGCTGAAGTGCGGGGACAGGGAGAGGGGATTATTTTATGCGTCG
TGGGGGGCTGAGCACACGGCCCGCGCGGTGCGGGTTCCGGGGACTTCTCCGTACCGTTGT
GAGTGGAAACTTGAGAATCTGAGCTTAGGCTCCATCCTGTGAACCCGCGAGGCCCCGGCG
TTTTGCAGATGAGGGCGTGAATGCTGTTGTTACCCAGGAGCGTTGGGGGTCTCTTATCTT
TTGCCGACCAACACGCATGTGTGGCTAGGGGCCTACGGGCGGAGCGGTGATGATCCCAAC
ATGCCATCTGAATGACCGTGCTGAGAACCAGAGGCTGTTTCTGAGCTGCTGCCCGACCCT
TGGGGAATGGGTGGACCCAGAGGGGCCTTCTAAGTGACATCTCCCGGCCGGCCGGCCCTT
TCCACCCTCTGTTCTCCTTTCCCCTTCTCTCTGTCGACTTGCTAGCATCTGGAGGCTTTT
TGTGCCTTCTGAAAGCCTCACGTATTAGAACTTGTCTCCTAGAATCNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved