Dasypus_novemcinctus Locus Mono:363:SNORA61
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:363:SNORA61
Dasypus_novemcinctus
Mono:363:SNORA61
GeneScaffold_5186
SNORA61
1001..1122
2122
GTAGAAGATTATTTGTTAATTCTTCCCAACTTGGTTAAAATTTCAATGAAAAGTTCATC
AAAAGCTCTTGATAAAATGATGCTAAAATTCATATGGAAGAATAAACGGTCAAGACTAGC
CAAGGCAAACATGAAAACTAAGAATAAAGGGGAGATAAAAACATATCCTATAATTATAAA
AACTGTGTCATAAGAATAGAAAAACAGATCAATGTAACTCAATGGAAAATCTAGACTTAG
AACTGTATATAAAGTAATTTAGCACATGATAAATGTGGTATTTCAAATTTGCCTGGAAAG
AATTCAATACATGGGATTGGGAACAACCCAACTGTCCATTAAAATCTAAGTCACATGGTC
ACAAAATTAAATCCTAAATGACTTGTAGACCTAAATTTAAAATACAAAACTGTTTAAGTA
TTAGTAGAAAATAGTTTGGGGTAGGAAAAGTTTTTAAACTATATATTTTTAAAACTGAGC
TTTACCAAAAACGATTGATACAATTGATTACATCAAAAGGAGAAAATTTTGTACAATAAA
AATCATAAAATTGAAAGATAAATGAGAGCCTGAGATAAAGATTTTGCAGCAAGGAAATAG
TATATAAAGAAGCTCCTATAAATTAACTTTTTAAAATGACACAATAGAAAATGGAATAAA
GTATAAAATAAGCAATTCATATAAGAAAAACAAATGGTGAATAAACCTATAAAAAGACAT
ATTCACTAAAAATCAGGGAAATACAATTTCACCAAGCTCCTTGGCAAAACTGGAAAAAAT
TTTCTTTAACTATATGTGTGGGAAAGGGCAGTCTCATTCACTGCTTGTGAGATGTAGATG
GATCAGCTAGTTTGGAGGGCATATGAACAGCAAATAATCAGCAATTATACTTTCTAATCT
CTACTATAGAGAAATTCCAACTAATGTTTGTAGGGAGGAATAATCAAGGATATTTGCTGC
TGTGCTCTTTGTGTTTCTGAGAGCATACATTTAGAAAAAGAACCCTCTGGTTCCCTTTCC
CATCCGATCCAAACACTGCTCTGGGTGATCCTAAAAGGAGGAAAAGGAACTCTGAAGCTG
ACCCCACAGTGCTTTGCAGCATGTCGGTTAGCTTCAAACAGGTTCAAACAAGGTTGAATT
CTCTTTAACTGCCCCCCTCCCCTCTATAATGGGCATAATCTTAGGCTTTTTGGAGGGATG
GGTAAAAGAGTAGATGTGAAGTTCTGGGCAGCTGGAAAAGAGCTATTCATATGCCCTCTT
AATTCTTTATTAGAGGTGTCCTCCTTTTTTAGGTCTGTGATACCGAGAAAGCCATCCTCA
TCTGTTTATGGACCTAGATTTGGGAGAAGAGGCAGGCTAAAAGGCACCTGGCTGGTTATT
AGGTGGAAATTGTGAACTCGGCAAGGAGAGTCCTTTGCTTTTTGTTGAGTGCTTATATCC
CTTGTGACTGACATTTTGGTGACCAATAAAATATTTACTCTATGGGAAAAAAATTTTAGA
AAAAGAAGTAAATATCCTTCAATAAGGGAATTACTCAATAAGCTATGTCCTATCTATGCT
ATGCAATCACTGTGCACAAATGCAAAAGGATCAAGATCTCAATGTATGGTATGGTATAAC
CTCTAGACAGATGGAGTGAAAAACATGTTGAAGTAAAATAAGTGCAGTATGGTGCCTTCT
ATGTGAAACACAGAAACACTACAGCTTTTCTATTGATGTGTATGTGTGCATGTGTGTATG
TGCTTGCAAAAGGCGTTGTTAGAGACCAACCGAAGAGAAAATGGAAGAGACTGCCACCTA
AGTGCCCGTCAAAAGAGACATTTCCTTTCACCTTTTTTTTTAAAGAATGCATTATTTGTG
TAAGTGGAAACTTATTTAAAGAGGAAAATTATGAACATGGCAGATGGTATTTTGCAAAGA
TGGCCACAACAATGTCTCCCATCCCATCTGCTCTTGGCAATGTGACCTTGCCGCACCTCA
TCAACTGTCAAATGGCAGAACCAACATCCAAAGCCTGAAAGTCTAAGGGCTCCCAAGATC
AAGCCCATCACGCTATCCGATACTGCTCTGAAGACAATCATCTCAATTAGTCCTTACCAT
GATCCTATAAGGTAATACTGCTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved