Dasypus_novemcinctus Locus Mono:407:SNORA16
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:407:SNORA16
Dasypus_novemcinctus
Mono:407:SNORA16
GeneScaffold_6006
SNORA16
1001..1132
2132
AGCACAGGTCCCGACCGCGCGGTCCCCGAATGGCCTTGCCCTCGTTATTAATAAATCCT
TTTCAACGGCAATGCCCCCTTAAATACTACAAATCATTTAATGAGGCTTTTGTATTAGCT
ATTTCACGTCACTCTTTAGGACAGCTCTGAGATACAGGCAATGCGTAAAGTAGGGCCTGG
GAAAATGAAATTCGGCCAAGGTCACTCGGTAAATTGGCAGTGACCCTGGATAAAGCNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNTCTCCCGGACGCCATTCCCGGGCGGCGTGGCCGGGCGACAACGCGCCAG
GCGTCTCCTGAGGCCGGGCCTGTACCGCACCCCTTTCCCGAGTGCCAGTACCTTAGGCTC
CGCTCCCCTCCGCCGCTGCCGCCCAGGCCTCGGGCCCCGGCCTCACGGCGGCCTCACGGC
GACCTCCGGCGGCCGCACGCGGGCGCAGCCATCTTGGCCGGCACGTGACCCAGCCCCAGC
GACTTCCGCCAGGGCTGCCCGCGGGGGAGGCGCGGGCGGGGGGGGGGGGGGGCTGCAAGT
TCCCCCCAGCCCCGCCCCCAAGGGCAGACAGCTCAGGGTTCTATGATGAATCTATTCATA
CTGGTTCACTTTTTCCTTTCCAATTTGGATACCTGTTGTTTCTTTTCTCTTGCCTCATTT
GCTCGGGCCAGAATGTCTCCTACAGCGTGGAAGAGCGGTGCTGGAAGCCCGCATCCTTGT
CCTGTTTCTGACCTTAGGGGGACAGCGCTTGTCTTTCACTACTAAGTATGATGTTAGCAG
TCGGTTTTTCGTAAATGGCCTTAATCATGTTTAGAAAGTTTTCTTCTAATTCTAGTTTTC
TGAGGACTCTTTTTTTTTTTTTAAATTACGGAAGGGTGCTGGGTGGCTCTCATCAAGGCT
GCAGCTGCTTCCACATAGCTACTGAGGACAAAAAGGAGCCCAGAGTGAAGTTTTCCTTGG
TGGTCGCCGTTCTGTTTGCTGTAACTGATCTAACATTTCAGGAAAAGCCAGTTTGCATTG
CACCTGCCCTTCCTCAGCTGTGCTGACTGAAAATTCCAGGATGACTGTGGTCTCTCAGGG
GAGTGAGGAGCCCAGAGAGCTTGCCCAGGTGCTGAAAGGCGAGCTCCTCAGCTCTGGCTA
CTCCCGAGGTTCCTCACAGTGTTCACAAGTCTGAAGATACTACCTTGTTGCTGGAGCAGA
TCCTTGACACCTAGAAAACTATCCTTGTCTGCCATTATGGGTCTAGAGTTGGGAGAAGCA
TGGTGGGAAAAGGAAGGCTAAAAGACACCTGGCTGATTGTTAGGTGGAAACCGTGAGCTC
GGCAAGCAGTGTCCTTTGTATCTCTGGTGTTAGAGTTTTCCCCTCACAAGGTTTGCAATG
ATTACCAGGTCATAAGGCTGTGGCTCCATTCTGATCGGTTGAGCAAGACGCCTACGTGCG
GAGGACAGCAGGCTTCCCCCCAAGAATGAGCCGTACCACAGTGGGAATGGAGCGGGTAAG
GACCCTCTCATCCCTTCCAGAGCACCAGACACCCGCATTCCAAGACCCATCCCTTCCAGA
TCATCAGAACCCTGCTTTCCAAAGCTACCCTACCCCAAGCCAGGCACAGAAGAATTCACT
TTTACAGCCCTGATTAACCTCAGGCTACAGCGGGACCCTAAGCCCCGCCCCGCGGACTGA
CGCGTCCCGCCTAGTGACGTGTGTGCAAGCCACGCCCACGGCTTCCACCAGCCCGCCCCA
GTCTCTGCAGACCCCCTCCGTGGCCTCCCTGCAAGCCTCAATCGCCGTGGCCCTGGGAGG
GCCGTTTTTCTCTACCACCTGGTATCTGGCATGTTGGTGACCAATAAAAGATTAATCTAT
GGAGGAAAAAAAGGGTGCTGGAGTTGGTAAATGGCCTTTCTGCCTTTATCGAGCTGATCA
TCCCGCACCCCGCCCCCATTCTTTTTATGTGGTGTATGACATTGATTGATTTTCTTGTGT
AGAACTACCCATACATTCCTGGGATAAATCCCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved