Dasypus_novemcinctus Locus Mono:377:SNORA63
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:377:SNORA63
Dasypus_novemcinctus
Mono:377:SNORA63
GeneScaffold_853
SNORA63
1001..1133
2133
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNATAACAGGGGGTTAGTATAAGGAGTATGGGAATTTTTTTCTCTTTGTGTT
AATGAAAAATTGACTATGGTGATGAATGCACAACTCTGATTATACTAAGAGTCACTGACT
GTACGTGGATGGATTGCATAGTGTGTGGATAAAACTATTTAAAAAAATAAAAGCAAGTAA
CTTGTGTTCCACTAACACCTTTTCTCTTTCTTTTTTCCAGTTTTCCCTGATTGGGATGAT
CCTTTTAGCATTTATAACTACCAGGATATAACATCTCATATCATAACCCCAGATGCAAGA
GCTACAAAATACAAAGCCATTTTTCAAAGTCTTTTTTTCATTGCAAATTTACTCAAACCC
CAGCAATAAATTCAACATTTACAAGGTTAACACTACAGACTGCTGGGTTAACTTTTTTTA
GCATAGGCCCCCTAGCAGTGAAACTTCAATAAAGCAAAGGATTAACCAACAGGGCAGCCA
GTGTCCTGAGCAAGTCCTCAGAGTAAACTGCACTGGAGGCCAGGATATTGGAGAAGGCAC
ATAAAACATGACTTTGCAGCCAGGTAAGACTTGGCTTTGATTCCAGCTCAGCCATTTATG
AGATGTGTGACAGGCAAATTTACTCATCCTCTCTGAATGTCAGTCTCCTCTTCTGTGAAA
TAGGTTGTAAAAATCCCTGTGTTTTCGACAGTTGAGAGGATTAAATGTTTTGTATTAAGT
GCCTGACACCCTGTAGATGCCAACTAAGGAAGGGTAAGTTCTTCCTCCCACATCTTCTTT
GTGGTGAACTGATTGTAAAGGGCAAGATGTCCTTAATTTTATTTTATTTTTTCTTTCTCT
CTTTTTTTTAGGAGGTACTGGGGATTGAACCTGGGACCTTGCACGTGTGAAGCAGGCACT
CAATCACTGAGCTACACCTGCCTTATTTTTAAAACATAAGAAAGCAGGATTTAGACTACA
ATTTAGCGGTTCATTGCTGTGTCATCATTCCTCCTGCTAAAAATGAAATTATTTTTTAAC
CTATCCCTGTGTGCTGAACTCTTGTAGCGGCCAGGGAGGCTTGGTCTCATACACGTTGAT
GGGAAAAAAAACACAACCACCTAAGAATGCCGTACCTCAAATTAAAAGGAGTTTAATTTC
CCAACAATAGTCTTAACTACCATTTATTGAATGTTTACCCTGAGCCAGGTGCTGTACTCA
TGCTTTACATGTTTGAATGCATTTAAGTCCTCATAACACCCCCTGCACATCTTCCTCATT
TTATGGATGATAAGCTGAGGTTCCACAAGGTGGGATAACTTACCCAAAGCAACAAATGGC
AGGGCTTGGATTTGATTTGCCTAACTCAAGTGCCCATATTCTTCACCACTAGGAATACTC
TCAAGACTGGCCCCTCAGGCCTCTACCAGAGAACTCTCTTTTCTGCTACCCTTGGCTTTC
TTCCCCGACTAAGCTGTACAATCTCTGTGTCCCAGGACTTGCCAGTGTTCCATCTTCCTG
GCCACAGTGATTATTTGAGGCTAATGAAAGCCGAGCACAGAGGTTTTGTCAGAGTTGTTG
GGGGAATTTTTCCATCAATTACTGGAGCTGTGGTGTGATTTGTGATGCATGAGAATGAAG
CTATCTCAAAGGAAAGCAGAGTTGAGAGAGAGTAGTCAAATTCCTGATGACACCGTTTTG
AGTCCTGGGATCCAGACTGAAGCCTAATTTTAGCGCTGGCCTTTTCAACTACATAAGCCA
ATAAATCCCCTCTTTGCCCTAAACCAACTGGGAAGAGTCCCAACCTATCCCCCCATTTGC
CTGTTTTTCTGGGAATATTCTGAGGACAAAGAGACTTTCTTCCTTCCCTGGGATTATTAA
AGTAATTGGTCTGATGACAGACTGTCCCTGGGGCAAGAGCCACCATGGAGACAGAGTCCA
GCTGGCCTTTCCTAGGATACACACTCACGATTGTCAAAACATTTTCAAACAGTATCAGCA
CATAATTATAGACATGTTTACTGCTTGTAGTAGCCATTGTTTTTGTCTTTCCAACACCTT
TTCTGGTAATAGGCTCTGCTGTTCCCATACCATG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved