Dasypus_novemcinctus Locus Mono:114:SNORA65
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:114:SNORA65
Dasypus_novemcinctus
Mono:114:SNORA65
scaffold_40946
SNORA65
1001..1130
2130
TTTCATTTTGGTGATGTTAGGTTTGGCAGTGAAAAATTCAAAAGTAGATATCAAGTAGT
GAGATGGAGTTTGGAGTTAAAAACAGATCAGCACTGGAGATGTAACTAAGGCAACACTGA
TCTACGAAGTATTTAAAATGATGGACCTAGATGAGATTACCCAAAGAGAATAATGTAAAG
AGAGGAGACAGTTAATTACCATGTTTGGTCCCTCTAATTTTGATGATCTATATTATCTTT
TTACTGAGAACAAGATCCTCTGACATGTATTTTTGAATTATCTCTCATAAATTTTATTTT
TTCAGATAACTAAGAATTATTTTATTTTGATTTTTCCAAATAGTATATTTTGACCCTAGC
TTGGGATTCCAATTTTAACTTTATTACCTCTTTTTTTTTTTTTCCAAACTTTAAGAGTAG
GACAGCTCATAGCTTATATCAGGGACAGCGTCATGCTACCATATTTCTAACACATATTCT
GTTCAGATTAGAAATGCCAGGTGACAGTTTCAAAATAAATTAGATTATATGAAGTAATCT
AAAAGAGTAAATATATTCTTTTAAAATATAAAACTCATTTATTCCCATATATCTAATAGC
TGATTTTTAAAATACTTTAATATATATGATATGATCTAATATTTTACGATATATGTATAT
TCAAGTGATTGCTTTCCTAATAAGTATATGACTTTAGCCCAGAGTTTATCTTAACATGTC
TACTGAATAGTCTATAACGTTCCCTGGGTTTTAACCATCTCAGGAGGGAAAAATTCAGTT
TGTAAAAAGGCTTTCTCACAAATCTATCACTTTTAGTTTGTGTTTGGAAATTTAGAATTC
ACAAAGTAACGCAAAGAAAATTAGAAAATATCACATTTTAAGGAACTCAATCTGTATCAT
ATTCTACCTCTGTACGATGAATACATATCAAGTAATCCATGCTACTTGATTTAATTAGCT
TTCTAAATTTCTAAAATTTAAATTTAAACACTTCATAACCACCTGCCACTGCACCTGACC
AGTTCTTTGTTGGCTGGTGAAATCCAGTGGTGAGATGATACTAAGCCCCAGCTTAGGAAA
CAGGCTTGTTCTTCATGCAGATGATTCTGTGCTGAAAGCATGACAACAGCCNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved