Dasypus_novemcinctus Locus Mono:164:SNORA62
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:164:SNORA62
Dasypus_novemcinctus
Mono:164:SNORA62
scaffold_66875
SNORA62
1001..1151
2151
AGCCCAAAGGGTGAAATGACTCATCCAAGATGGAAGTATGTATATTTTGAGAGCATAAG
GAAAAGGGAGCCAAAAAAAACCCAAAAAACAAAAAACCAACCAAACAAAAAAACACACTA
AAGGAAGTAGCTAGAAAGAATTTCTAAAATGGAGATTGCTCAAATTTTTGCATTTGTGTT
ATGAACTGAAAGAGAAAATACTTCCTATTAAATAAGAGTTATTGAGTAATGGTGAACACA
GAAAGTTTGCTTATGGGTCTCTTTGAGTGCCATATCAAATAAAGAATTTTTTCTAGGTAG
AATTGACTGGAATTTGGGGGCAGATGCTCTCTCGTTTCATTAACTATAAAGGCTTTTATT
GAGCATCTCACTTGTGGTCACAGTTTGGATGAGAGGCGTGTAACAGCATGGCGGGGTGAG
CGGTGGGATGACAAAGTTGTGCATGGCGTTGGGGCTTGGGCAGGATCCATCTGTGTTTAG
GCATCAGGATAGATCAATGATTAGAAAGCAATAAGCATTGCAAACATTAGGCATATGTTC
AAACATGAATCACCGCAAAAAGGCTGAGGTTAATGTGAACGCCTCTCACTTCTTTAATAG
AAAATCGAGCCGGCCCGCGCCTCCATCCACAGACTCAGCGAGGCCTGTGTGGTTTCCATG
TGGTCAGAAGCATTAGTTAGGGTCTTGTCCCTATCTATTAGGAGGCAGGAAGCCCATTTA
GCAAATTAAAATGGTTTTTATTCCCCCAGCTAATTGTTTTCTAATTGTTTAAGTAAAAGG
TTTTGGTCTTGATTAGAGGCTTTTAGTAAATTAAATCTGTTCACATTTCACAAGTCTAAA
ATTTACACCATAGAGAGGCAGTTATGGTTAGTGAGGTTTGCTATAGCAAGGGTTTTAAAA
CATAAATGTGCATGCTGAATAGGTCTTAGAGATTATCTGTTCAACACTCTCATCTTAGCA
CTGAAGGAACGGAGGCACAGAGAGGGTAACAGACTGACCCAACTGCACACTGTTAAAGCT
CAGGGTGGAGGCCAGTCTTAGCCAGTGACCTTCTGAGTGTCGGAAGTGTGCTCTATCAAT
GGCAGGATTTTCGCTGACGCCAGCAGAGCTTGCCTCTATGACTGGAGTTTGATAGTACTC
GCTGCCACCGATAAAAACAAAACAAAACAAAAAAACNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved