Dasypus_novemcinctus Locus Poly:17:SNORND104
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Poly:17:SNORND104
Dasypus_novemcinctus
Poly:17:SNORND104
GeneScaffold_3447
SNORND104, SNORA76
1001..1070, 1256..1386
2386
TACAAAAGAGATGAACCTTGAAAACATTTTGCTAAGTAAAAAAAGCCAGACAAAAAAGG
ACAAATATTGTATGATTCCACTTCTGTGAAATCTCTAGAATAAGCAAATTTATAGATAGA
AAGAGTAGAAGTTACCAGGGGTTCGCAGGGACGGGCAATGGGGGGGTGCTTAATCAGCAG
TTTCTACTTTGGGTCAAAAAGTTTTGGTAATGGATAGTGATAACGGCTGCACAATATTGT
AAATAAAACTAATGCCACCGAATTGCAGATTTAAAAAGGGTTAAAAGGGCCCGTTTTTTT
ATATACGTATTACCACAATTAAACAAACATACATTTATCACTGAGACTGTGCCAAGCAAT
CGATATAGCAATTCATTTAATCCTTACAACTTTATTGGATATTATTTCCATTTTTAGAAA
TTGAGGCTCAGAAAAGAACAATGCATCACGAGGGCAGGATGTGGGCGCAAACGATCTTTT
AAAGCACAAGCTCTTTCTATCACATCAGGTTACTTTGAACTCAGAGGCACGCAGTTTTGT
TTACCTTTACATCCTCAGCAACTAGCCTTGCCCCTGGCACACACTATTTCAAGCAAGTCA
GGCACTAACTGTCCTTGTTGCAGTTTTCTTTTGTGTACCGTAGAGAGATGTACAACTTAG
AGCCGACTATCCAGGTGGGTATACGAACTTCGGAAGCTGTATGATTCTCAAACCTTTCCT
ATGTCTTTCCGTAACTCCTAACTCTATGGTTGACGAGACCACTCTATACCCTGGAGGACT
AAGCGAACACGGCCAATCACTAGGCCACGTTGCTCACATGTGGTCCGACGTCTGGGTTGC
TATTGGTTAATAACATTAAAGCCCGCCCAACCGCCGCCCACCCCTTCACTAAATAGGCGC
TGTAGGGGCGCTCTGGTCTTTCCGCAGCTGCGAGGCTGGGAGGTGAGGTGCAGGTCCAGT
GGGTCTCGGGTCGCGGTTCCAGTGTGGGAGGCGGGCGGCCCGCGGTGATGACATTCCAAT
TAAAGCACGTGTTAGACTGCTGACGCTGGTGATGCGAACTGGAGTCTGAGCCGGGCGGCC
GGGGCGGCGGGACGGGAACGGGCCGGCGGGTGCACGTCCGCTCACGTCCGCTCTTCTTGC
AGGTCCCGCCGGTTTGCCGACATCGGACCTCGTCCCCACCCCTTCCTCCACCCCCTAGAA
GTCCCGCAATAAAATGGCTTGGCACTAACGTTGGTGTCGTGTCTTCTGTCCGCGACGCGC
TGCCTTTGAGCCCCCGTCGCGCCTGCGCGTGGCGCCGGGGGTTAAGCTGCAGCGCCAGAG
CACGTGCTTGCGCATAACTGGGGCCGCCCGACCGTACGGGCGGCGCCTTTAACCGCGAGC
GACAAGCCAGCCTGGGCTGCGCAGAGGGTGTGCAACGATTTAGGCCTCAGCCCTTAACCG
CCAACCCGCCCCCCCCCCCCCCCAGCCGCTCAGGGCTGGAATGCCTGGGGAGATGACGGG
GCTCATGTAGGGGTGGGCCTTAAGCCTCTGTCCTCTTCTGTCTTATATGAAGGCATGCTG
CTGTGCCGTCACTGCGAGTCCCGGGCTGTCATCCCTCCCAGGGATTTTTTCAATGGCTTG
GGATGCCTGCAGGGAGGGTGAAGAAACTCGGGCTTAGGCCTTGAGCCCCAGTGTAAAGGC
CGTGGTCTATTTGGTAAAGTGGCTTTGGGCGTGAGCTGTGTGATGTGCTTAACTCATCTG
GCAAAGGTGCTGCTCCGACTTACTTAGGAAAACTTCCATCGGGCCGCTGCTTATTTGGAT
ACAGTCTTGTCAGGCATGTGTGGCCAAAGCTTTGAGTCTAATAGGCTCACGGTAACAAGG
TGGTTGTGAAGTACATTTCATATGTGGCTGAGCACCAAACTACGCACGTAAGTAATCACA
AAATCACTTAATAGTTAACATTCTACAGCTAGGCTCAAGGGAAAAGTGCATCAAGTACAA
AACTGGAAAGACAAGGATGAATGGGTGAGGCATTTAACAACTAGACTCGGTTCTTTACAT
TTGGACTGAGGATCATAGCACCTACTTCATAGAGGTGCTGGGATGAGGAGTACCTAAATA
GCCCCTCTGAACAATTTACTGGTCCAGAGCCCAGTCAGTGAAAGCTGTTGGGCGAGGGCC
CCTCTAAGCAGATTGAGTAGAAATAAATTAGATGCTTACCTAGTATTTGACATGAGATAT
TTATTTTGTGAAACAATGCAAGCGATTGTAAATTCCCCATACTATTTAAGTGCAACAGAG
TACAGTCATGTGTAATCTCTACACAGTAGTGCGTCTAGTGCTTTGCCTTTAGTTATTGCA
CAAAAATTAAAAGACCAGTGAACAAGACGTAGACTCTTGACAGGCAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved