Dasypus_novemcinctus Locus Mono:337:SNORD56
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:337:SNORD56
Dasypus_novemcinctus
Mono:337:SNORD56
scaffold_262044
SNORD56
1001..1075
1382
TCCACCTTTACTCAGTACTGTAGTATGCTTATTTTTTTCTGAGCAAAAAGGCTAATCAA
ATTATAAGGCTCAGTTACCCCAGGGCATTATTAAAAATAATTTTTAAAAAATATTTCTCA
GTCACATGTTCAAAATCACATAGGAATTTAGTGTATATTTACATACAATGAATGGAAAAA
GAACAACATGCATTACATTGGTTTTACAAGCAGATTCCAGAAAATACTTGACATCTGATT
TTTCAAAAATTTTATCATCATTTTAGTATTTACTTGCAAGGTATTGGAGAGAAATTAAAA
TAATAATCCTACAATGATGGCAATATTTTTTGTCATCAGCAGTTCACCTATAGAGTGAGT
GTTGATAGTTTGGGTCTGAATGAAGTTGAGAAAAGAAGAATTTTTAAAAATCATAATCCT
CTGATTAGGATGATGAGATCAGAGGACAGAGAGGTTAAGTTTCAAATGTGTCAGCCATTC
ATTAGAATGGTAAAGGTGTCTGTCATGGTAACAATCTTGTTTTGGAGAGGGAAGTGGTGA
AGGAAGGTCTATTGTGTTCAATGAATAAATGGGAGTGACAGAGTGATGTGAAAATAAAAG
TAGTGCCTAGCTTACAACAATATATAAAAGAATGGGAATCAAAACTTGTTAGAAGTCCAG
AAAAGAAAACAACAACAACAACAACAGCAACAACAACAACAATGAGGGATTGAATACTGT
CAGTGATAGGGTTTGAGTGGGGGAAGTTCTAGAGACTGCTTAAGGAATTTCTCCTACAGT
GTAACCTCAGTGGCAGTGGGAATTGAAAAGGACAAGATAGGCTATACTGCATTAAAAAAT
AAACTCTGAAACATGACACAAGTTGAATGCAAAGTTTGTGGAAAGTTCACTGGAGGCCAG
TGGTTCTTCTCCTTCATACTCTGAATCTGGGACCAATCTTTCCCCATCTCATTATACTAC
CATCTAAGTTCAATTCTCCAAATCATGGAGAAGTCAATGGGTAGCAGGGTAAATTGTGTG
GGCTCATTACTTCAAAAGAAAAAAAGAGACAGAATGTTAAAAAAAATAAGGAAAAATCAT
CTCTGAGAATACCTTTGATATTTCAAAAATTTTGAACCATGTGTATGTGTTTGTGCATGT
GTGTCACCCAAAAATAAAATTAAATCAGTGAGAAAGCCTTAATATGAAACACAAGGATAA
AATAAACAAAGATAAAACAAATATAAATTTATACCAAATAAATAAGATAAAGATGTAAGG
AAATAAAAATTATTTCAAGCAGTGCTTATATATAGTTCTCTGACTGTATATTTTAAGTAG
GATATATTTTAAAGCATGAGAAGTAAAGAGATTTTTAAAGCTCACTCAGTAATATAGTTA
ATA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved