Dasypus_novemcinctus Locus Mono:397:SNORD14
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:397:SNORD14
Dasypus_novemcinctus
Mono:397:SNORD14
GeneScaffold_1854
SNORD14
1001..1091
2091
CTGTGTGTGGTCGCAGGAGCTCCGTGGGGTGCCGAGGGCCCACCACGCACCCACGCTCC
AGCCTTCACAGCTGCTTTTCTCTGTGGGACTGCTTTTTCCCTGGAGGTCCACATGGCTTT
CTCCTTCGCCTCCTTTAAATCTCTGCTCTGACATCAACTGCTTATCGGAGAGTTTCTTGA
CCACCTGCTTAAAATAGTAACAACTCCTACTCCATACAGTTCCCTAATTTATTTCTCTTA
ACACTTATCACCGGCTAATATACTTAGAAATTAGGCATAAAGTCTCTGCCAGTGAGGATG
TACACTCATGAAGGCAATGAATTTTGTTTGTTCTGTTAATTACCCAGCACGTAGAAGGCA
ATCATTAAATATTAACTGAACTAAATTAAATTTCGCACTCGTAGGTGTAGTTAGGTATAT
GTCTTGCTTTCCTTAGTCAAGTGTAAGCTCCATTAGAATATACCTACCCGAATGCCTTAC
ATATATCATAAGCTCTCAAAAATATCTGTGGGATGAAAGAATACAACGCCAAAACAGGTA
TACCGATTGGCTCACTTAATGATTTTATCTGTAAGAATCTCACTATCCAAAAGGGACTCA
AGATGCTTACTAAGGAATTGAAATCAAGAGAGTCCACGCCTTCCTCCCAAGGCAGACCAC
TCACCTTTGCTGGTTCGGAAGGTAAGCATGGCAGGCTGCCCTTCACCAGCTGCACTCCTG
GCCACCATCAAGACTTCATAGAGACTGGAAGGCTCCAGCTCAGTTAGGTGGAGTTCATTT
TCACTTCCTGGGACCCGGACCGTGTGCCAGCTTCCCACCACACCGACAGCATCATCCAGC
TGCTCAGGGGAGAATAAACCAAAGAGAAACAGGTGAAGGGCAGAGAAGCCTTTCAGCCAC
ATCTGATAATAACTACACTTTCATTCTAGATGAACAGTGGGATGTGATATAGCATTGTAA
GTGGAAGAGGCAAGGTTTCTTCCCATTAAGAAATACAAGGATCACAATGATGAAACTGTC
CAAACATTCACAGTTTCCACCAAAATTCACCTTGTGTTGGAACATCAGCTTCTTCCCGGG
ATGTCTGAGTGACCAAGAGCTCATGGAATAGCCAAGATCTTTTGTAATGGGACAGTGGGC
TTTGTGCTCCAGTGTTTCATTCCAAGGCTCTAAACATTAGGGTACATCAGACATACCTCT
TAGGGAAGGTTCCAGCTGCTTGAAAAACCTTTGGTAATAAAATATTCTGCCCCACCCCAA
AAGAGAAAATAAATATAAGGAGACCTGTGGCAAGAACTCAGGAATTCTCAGAGTCTGAGA
AAAAAATAAATTTCTAGACTTCTGGCTCTGCTACTTACCACCACCCTGTCACCTCAGGCA
AGTTATTATGCCTTGCAGAGTAAGTTTCCTTCATGTATAGTATCTCCTTTCTTACTGGGT
TAATGGGAGAATAAAATACACATGTGATGTCTTAGTGAAATATAGAATATACATAATAAG
CATATGAGAAATTAAAATATCATATATGTTTGTGTATATGTGTGTATATATATTGCATGG
TTGTGATTAAGTATTATCTATTTCCAGTATCTTGCTTGCTTCACATCTTGATACATAACA
TCTGTTCAATATGTGTTGTAAAAAAAAATAAAAAGACAACCAGTCAGTTGTGTCTTGCTT
AATAGAACCAAGAGACATTATCGCATGGAGATTTCTTACTTTCTTACTTTCCTCATCTAG
AATCATCAGGTAAGAAACAGGGGATAAACTTTAAAATAGCACCATGTTAATTTTTCCAGT
CATTAAAAATATTACTACTAAATAATGGATACCCAAACAAGTTGTGGATAAAGACAATTA
CTTTAAACATGACCGCATCCTCTCCCATTTCATTTACTAGTCTCCTTAAACTAAGAGATT
TCTCGTTTTGCTCTAATATAAGCCTAAGAAAGGAAAGCATTATCTGAAAAGTCAACTTGG
AGAGGATGAAGGCTTTACCAAATGCAATGACCAAACAACCTAAAATTCTAATGCAGTTAC
CACTTGAAGTGCAAACAACTGTCAGATTATACCAGAGGCCTCTGTTCAGGTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved