Dasypus_novemcinctus Locus Mono:253:SNORA21
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:253:SNORA21
Dasypus_novemcinctus
Mono:253:SNORA21
scaffold_1970
SNORA21
1001..1136
2136
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGTTAAA
AAGAACTTTCCTTCATTAGGTAGGGCTATTTTTTTAGCCTGAAACTGAGCTTTTACAAGG
CAGGTGGAATAAATGTTAAATTCCTTCTATTTCACTTACCAATTTTAGAACAGGTGTGGC
CTGGCTGCCTCCAGTGATGACCAGAGAGTTTGTTGGTGGTGGTGATGGAGGGGCTGTTTT
GTTATTTTGATTTCTCTCTATTTTTTGTGTACCACTGTGAGTGCATAGGTGTATATATAG
TCAATAGGTCTCAATCCATTGTAACCATCATTGTTGTTTTGTTTTATTTAATGATCAGAT
TGTCTTATCTTTTCCCCATGGGTGCCCTTTCAGGTTGGCTCTTACGTCCTTTGGCCATGT
CTCCATTAATGGCATTAATGTGCCATTAAAGGCACATTACACCATTCCAGACTCCTCTCG
AATATTCCCTGCATCGGAAGTGGAGGCATCCATTTCTCCAGGGGGCCCTGGTTCCTCCTT
GTGAGGGGAGAGCAGAGACTACAAATTAGGCCTTGCTGTTTAATTGATTATTAGAAAATT
AAAAAAGAAAAAAATACACAACAGCAATAGGTCATTTTTCAAGAATGCCATATGATACTG
CTTGTCTTTTTTGTTGATTTATGTAAAAGACTTTGAAAGCAGGTGCTTTTGACTTCATGA
AGATGGTGCCACAAATATTATAATAAAAGTTAATATTTATTAGGTACTTATAATATGCAA
ATCATTGTGCTAAGTACACACATTAGCCTGAACCTTAATTCTCCCAACAACTTTTTGCCA
ATATTATTTTTATCCCAGTTTTACAAATAAGGGAGCTCACATTTTGAGAGGCAGGACAAC
ATGCCCAAAGTCATAATGACTAGCAAATGACGGGTGACTCTCCCCTTTTAAAAGCTCTCA
TTGGGCCTTTTCTTGATGACCCTCCAAGCCATCATGAAAGGGCAGAATAAAAACATTGCT
TCTGGGTGAAGTGACAGTCTCTTGTGTTGTTTTGCTTCAATTGGTGGCATGACAGGACTT
AAAAAAAAAAAGAAAAGAGGGTGAATCTGATTTCATCCCTGCATCCCTGGTCTGTGTGAC
TCCAGAGATTGTGCTCTTAACTTGAAAACTACACTGCTTCTTTAGGTACTTACATAGTTT
TATTGCTACAACTATCACATTCCATATATGATTTCCTTCTTATTACCTCTTATAATTGGA
AACTCTGAAGGTAGATATGAAATCTATATATAAACTCTAGGTGTTATTGTAATGAACAGT
TTTTAACTTTCTTTTTTTTTTTTTTAAAGATTTATTTTTATTTATTTAATTCCCCTCCCC
TCTCCCGGTTGTCTGTTTTCTGTGTCTTTTTTGCTGAGTCTTGCTTCTTTGTCTGCTTCT
GTTGTCGTCAGCGGCACGGGAAGTGTGGGCGGCGCCATTCCTCGGCAGGCTGCTCCCTCC
TTCGCGCTGGGCGGCTCTCCTTATGGGCGCACTCCTTGCGCGTGGGGCTCCCCTACGCGG
GGGACACCCCTGCATGGCAGGGCACTCCTTGCGCGCATCAGCACTGCGCATGGGCCAGCT
CCACATGGGTCAAGGAGGCCCGGGGCTTGAACCGCGGACCTCCCATGTGGTAGACGGACG
CCCTAACCACTGGGCCAAAGACCGTTTCCCAGTTTTTAACTTTCTCATACATTATGCCTC
TATAGAGATTTTAAATAAGAAACAAAAATTATTACTTTAAAATCCAACTCTCTCTATATT
TGGTGTTTGCACAATGTAGACGACAAGCCCTGGGAAGCACTGAGAAGATCAGGAAAAAGG
CAGGACCCACATCAACCTGTTTAGATCGCTGACCCCTGAGTAGTGAAGAGATAGGTGACA
TTTTGCCTTTGGGTGCACCCGCTTCTTGCTGCATGCTTTCCTCACTCCTAAGATGTCACC
CTGTTAAAAGCCATATGGGAGAGGAACAGAATATTCAATTCCTAATCAAGGGTGAAACAC
TAGTGGGGTAAAGAGCTTCTTTTTCCTGGGAAAGGCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved