Dasypus_novemcinctus Locus Mono:413:SNORA67
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:413:SNORA67
Dasypus_novemcinctus
Mono:413:SNORA67
GeneScaffold_5
SNORA67
1001..1141
2141
TGGAAGCTGGTCCATCAATCCCAAAGCCATCTTCACAGTTATATGTAACTTCTTTTCCA
TGTTGGTAACTGTCTAATCTTGGAGAAGGAGCACCATAAGAAATCACAGGTGGCTCTTCA
CATGGATTTCCTATGCACTGAGGTATAGAACTCCATTTTCCCATGTGGCATGTTATCTCA
TCTTGCATCTGTACCATCAACCACAATTCTCATCCACCTCTTGGTTTACTGTGCTATCCA
GTTCCTAGATTATTCTCAAGCATTCTGTCAATTGGCATTTACATAACTAAACTACCATTT
TCAGTTATATCCCCATTTATAAACTAGCTGTTACTCACTGTGTGTTACTCTTCCAATCCA
TGAGCATGGAATGTTCATATAGTTATTTAGGGCTTTTTTGATCTGTTTTAACATTGAGTT
GCAGTTTTCTGAATAGAAGTGCTTTACAACATTGGTTAAATTTATTCCTATTTGAGTTTT
AACTGTCATATTTTATTTTCACCACTCTTTTGCCACTTTTAATTACTTTTATTGAGATAA
TATTCGTTTCTAGACTCTCTTCCAGGCCTCTTTCTCCTGTCTTTTCTTCTCAGGCTCTAG
CACACTCTTTAGTATTTCCTGAAAATCTGGTCTCTTGCTTAGAAATTCTTTCAGTTTCTG
TTTATCTGTGAATATTCTAATTTCACCCTCATTTTTGAAAGACAATCTTGCTGGATATAA
GATTCTCGGCTGGAAGTTTTTCTCTTCTAGTATCTTAAATATATCAGACCACTGTCTTTT
GCCTCCATGGTTTCTGGTGAGAAATCAGCACGTAATCTTATTGGATATCCCTTATCTGTG
ATACATTGCTTTTCTCTTGCTGCTCTCAGAATTCCCTCTTTGTCTTTGGCCTTTGACATT
CTGATGAGTATGTGTTTTGGAGCTGGTCTATTTGGATTTTTTCAGATGGGAGTACATTGT
GCTTCTTGAACAGGGATATCTATGTCCTTCAATAGGTTTGGGTCCAAGGTGATTCCCTCT
CCAAGGGGCCACCTAATGCCCCTCTCAAGAAAGTAGCAACTTGGAATAAAACCTGGCAAG
CCCAGGGTTTTCCAGAGAGAGGGGATGATTTTCCTTTTGCCTTCCTTTGGCTGCCTACAT
GCCTAAAAAAAATAAAAATAAATAAAAATAGGTTTGGGAAATTTACTACAATTATTTCTT
TAAAATATTCTTTCTGCCCCTTTTTCATTCTCTTCTCCTTCTGAGACACCCATGACACAT
ATGTTTGCATGCCTTATGCTGTCATTTAGTTGCCTGAGACCTTGTTCAAATTTTTCCATT
CTTTTCTTCATCTCTTCTTTTGTATGTTCACTTTCAGAGGCCATTTCTTCAAGCTCAGCA
ATCCTTTCTTAAACTTCCTCAAATCTGCTATTATACGATTCCAATGTTTTTTCAATTTAA
TTGATTGTACCTTTCATTCCCATAAGATCTGCTATTTTTCTATGTATGCTTTCAAATTCT
TCTTTGTGCTCATCCAGTGTCTTCTTAATATCCTTAATCTCTTTAGCCATCTCTTTGAAT
TTATTTGTTTGAACATCTATAATTAGTTGTCCCAACTCCTTTATGTCATCCAGAGGCTTA
TCTTGTTTCTTTAACTGGGCCATAGCTTCCTGTTTCTTGATGTGGATAGTAATTTTTTGT
TTGTGTCTTGGCATCTGGCTTACTAGAGTATTTTTTCTGGGTTCAGTTTTTCTCTTTAGT
TCAGGGCTTCCTATTATTTCTCCCTTGCTGGTTGTGCAGTAGGAGCCAAGCATGTAGTTG
GTGCTGTAAGCTGTGGAGTCTGAAGCTGCCCTCATTTCACCAGGCTCCAATGAAGCTTCT
TCCAACTTTCTCCCTTGCCAGGGGTAGGGACAGAGTCCCAGCTGTGTGGAATAATCCAAG
TGCAGGCCTAGACTGTAGTTGCCCAGAGAGACTGATGAAGCTTCACATCCCTTTCTCCCC
TACCTGGGGCAGGGATAGAGCTGCAGGTGAGGGCAGCAGTCTATGCAGTGTGGGTCTAAG
ATGACCACATTTGCCCTGGTAGACTTCTGATTTTCAGTCTATGGCAGCCAAAGTTACCTG
CAGTTACCTGTATAGGCTGGTGCAGGGATCCTCAGCCTCCAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved