Dasypus_novemcinctus Locus Mono:434:SNORA42
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:434:SNORA42
Dasypus_novemcinctus
Mono:434:SNORA42
GeneScaffold_4813
SNORA42
1001..1128
2128
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCATAGGTTTGGATTTATG
GCAGGCCCGTCCCCATGGACCTCTCATAATATCCCATTTCAGAGCTAACTGTAGCGCCGA
ACCATTGCCTGGTCTTGTAGGCCTCAGCACTGAAGGGGGTTGCACAGTGTAAAAGAAAAA
GAAAAAAGAAAAAATTTAAAAATTAAAAAAAAACAAAAACCAGATGGTTCTTTTATGTTC
TCTATTGATACCTCCTAAGCACCATTACTGCCACACTCCCCTCAATGGCATGTGCACCAG
AAGATTAAGGCCACTGACAGAATAGCCTTTGCTCTTTATACTGGTGAAAATTCAAGGAAT
TAATCTTTGTTTTCTTATTCAAAGACAAAACTATCTAAGAAGACGGGAGATTTCAGGAGA
GTCCGGTGATAAAAGAAAAGATGTTTGGCCAGCTGAAAACATAGGCCTTTCCATTTAGTT
TTCAGGCTGAAAGAGCAGAAGTGGAAAAAAGTGACAAATAGCTATCACATATGATTGAAG
TACAGACTTTCATAGGTAATAAGTTTCCCCTTCATAATGAAAACATCCTGCAATCTAGAC
TAATTAAGAGTCATGACAATTTCAGTAGCATCATTCAATAGCATATTATATGATGCTATG
ATTCAATAGCATCATTATAAAGGCAATGATACTCCTAATTAAGGTGCTAGTTTTAATAAG
AAAGTGATAGAGCAGCACCACATGAATAGCTTTACCTTTACTTCAAAGTCTACACACCTG
TAAGTGAATCTGTCACTGTGGCTAAAATTTCTACTGGCCCAGCGGAAGACAGATGCACGT
ATTCAGAAAGGCTATTTGAAAAATCCATTACTTCTTTCATTTCTTCATCATTAAAGGAGA
AGTGTGCAGATCCATTTATCTGTTTTGTTAAAAAGTTCAATTTTATTTTTCACTTTAGCA
ATTCAAATTGAAGAAATACATAAAATTCTAAGTCACAACAATACAATGGCTTCTGGTTCC
ATTTTAATCACTATAAATGGGTAAATTCCCATTTGTTTATACTGGGAAACTCTTGCTTTT
CTTATACTCTGTCAATTTTTGTCCATTAAATACAAAAATTTTATTTCCAGAAAAAATACA
TTTACAGTTTTCCCCATTATAAATTATAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved