Dasypus_novemcinctus Locus Mono:406:SNORA8
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:406:SNORA8
Dasypus_novemcinctus
Mono:406:SNORA8
GeneScaffold_6686
SNORA8
1001..1140
2140
AAATAGTACCAATGGGTAGAACCTCTAGGCAACTGGCAGAAGTGAACACAGATCTCTGA
AGACTCCACCTTCAGCCCAGGCCTCCAAAGAAGTCCCACCTATAGTTCATGGAATGTGAG
CGCAGTGAAAAGTCAGAGTAGAAGAAAGCAAGGCATCATGAGAGCCTGCCCAAAAAAAAG
ATGGGATAATAACCACAAAGAAAATGTTGATATTACAGACTTTTAAGGATTGTAAACAAA
GAAACAAGATAATTAGGTAAGGAACAAGAAACTACTACAAATCACAGCAAGCAGAATTGG
GAAAGAACCAAATAAAACTTATAAAAATGAAAAAATAACAAAGTTGAAAAGGAAGTAAAA
CTAGTTACAAGTATAGCTTGTAAAGTGTACTTTGCCAAATTTGAAATGTATAAATAACCT
GTGGAATGAAATAGGTACTAGCACTTTGGATTTTCTTTTGATTATACCATTAGAATCTCA
AGTCACCTTACAAGATTTCTGCAGACCACAACATAGAGTAGTTGGGTGATTCAAGCCTTT
GCCAAGCTCTGCTTCATACTATAGCGATGTCAACCCTGAACCTTGTTTCAGAAGAGAACA
ATTTTTATGAGGATTTGCCCAGTTTCCAGAAGGCTGTCTGATTGCTTTAAAAATAATCTA
AAAATCATACTATGTAATAACAAATTTTGTTGTGGTTTGGTTACCATTTGATCTCCAGAG
TAAAAACAAGGGATCTGATAATATATGGTTCTGAATGTCAGTGACAAAGTATTTAGTGAT
GTATGCTCAAGAGTGTTTTGTACATTGCAGTTCCCAATCTCATTATGCAGCAGGAAATTG
AGGGTCTTTTCTAGCATTTTTTTTTTAAGGAATGGGAGAAAATATAATGGGACAGAAAAT
ACCAGTGTGCTCTACATGTTCTAAGGGTATGTATCTTTTGATATGAGTCATGTTTAGGTT
TGGGCATCTATAGGTACTGGATCACTGTAAAATGTTTTACTTAAAGTGAATAGTTACCTG
CACTCAGCATTTTTTTTCTTGCTGGGGAGTTCAAAGACAGTGCTATAGAAATTCAGTATC
TGGCATCGTTGGTTTTCTTGGCTTTGTGCATGTTAAACCTGTTATTTCTATTGATACAGT
ATTTCCATAGTTTTTCCAGTACTGTTCAGATTGGTATAATCATCAATAAGAATAAATTCT
TCAAAAATAAAAATAAAAAAATAAAGAGAATAGTGGCAAAAAGTTTGAAAGCCACCAATC
AGAGCATACGAAAGATGGTTCTAGTAACAACTTTTATGTGAAGATTTAATTTTTAAAAAT
ATAAAATGTGCTTTTCAAAATACACATGACAGATATATTCACCAAATGCAATGAATGTCT
CATGATAATGGAGGAGATTGTTGCTATGGGGGGAGGAGTGGGATAAAGGGGGTGTGGGGT
ATATGGGGACCTCATTTTTTTAATGTGATATTAAAAATTAAAGACAAAAAAAAAAACATG
ACTTTTGTCATTGATTTTGCATTATTCCTATAAATACCAATTAAGTAAAGCTACATTGCA
CAATGTTATGGGAAAGGAGCAAATAATTTGATTTAAAGTGGGATCTTTAATGACTTTGTA
AATCCTTAATACAAAACTCTTGCATGGCAGATTTTGCTTAGATGAAGAACTGAAAACATT
TAGGAGGCAATGTCTGAATAAATCTAATAGCTTAAATTTCTTAGTGATGGGATCCTAAAA
TAAAATTACTTCACTTTTCCCACCATTTCTAGATGAATAATCATTTGCTTATTTGGATCC
CTGTGTAAATCTGGTTTCCAAAATGCATTGCTCTCTACTAGGCTGACGGTGGTGAGGAGG
CAGGACACGTCCCCACCCGGTTCCTTTCCCCTGTTTGTTATGCGGGCGCCCGGGGGCTTG
TAAGTGATCCGGCAGGTTTCTCTGTGCCTTCCGTAGCTATATCCTTTTCTGTGCCTTCCA
CTAAGATTGGTCCTGTTGGAAAACTATCCTCGATATTTTAAACAAACTATCTCTATGCCC
AGATCTTTTCCCTTTTGTTAGTAAAGGGAATGTAATTTTAAAAGGAGGAAACTGCCCACA
GGAAAGTAATGCAGATACAAACATTTTGCTTCACAATTAAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved