Dasypus_novemcinctus Locus Mono:389:SNORA3
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:389:SNORA3
Dasypus_novemcinctus
Mono:389:SNORA3
GeneScaffold_2634
SNORA3
1001..1118
2118
AAAATCAAAGGAACACGGAAGACAAAGTAGAACCCATTGCCATAAGCATTGCCATGTAG
ACAGAAAAACCAAAGATCTGAGGATCATTGTAAGGCAGCCCCAGAACACCACAGTCTCTG
GGGAGAAAGCATTGCCTTACTGATGCTTTGATTTTGCTTCCTAGTCCCTAAACTGTGAGC
CAATAAATTCCCATTGTTTAAGCCAACCCACTTGATGGCTTTTGTTTTAGCAACTAGAAA
CCTAAAACGGATGGGTTTGATTCTGGCTAGGTGATAATTGCAATTTTTAAGCCATTTTCT
GCTCTACCTTGAAAAGCATTTATTGAGTACAGCAGAAGATGGATATTTAATATGTTTTTT
AATGATAGAAATTTTAATGTATTTTCTTGAGTAATCAGGTTTTATACATCCTGAAACTAG
TGCTCTTTTTCAAAAAGTCTCTAGAAACACTTATTTCTCCTTCGGGTTGTATTTTCAAAC
ATATGCCAACAATTAGAGCTCTGATTTCAGTATTTCCCTTCCCCTCACTGGCAATTTTAA
GCTAGTTTTGTGAGCATTTTAAATTATTATCCACCCCAAATACTGGCTCTCTTTCATGTA
TTGCTTAACATTTTTCAACACAATAAATATTGTAGTTTATCAAGATCAAAACAGCAAAAC
ATGATCTTTAATAGTAACAGCATTCTGGTACAAAATCAACACCTGGGAAGAATTACTGAG
TTTTATGCACAAAAGACAGCAAGCACTTTGCATGTGAATGCACATACTAGAAGCAGAAAT
AAAATACAGCAATCTTATTTAGAAAGCGAAGGTCTTAAATTATAAAACCAGAGTATATTG
TTAAATTTAATAGATAAAACTTCCTGTAAAATGTAAATTTTAACCGTTACAAATCATTTG
ATATCTATGCATTAGTTTCCTTATCTCTAAATCAAAGTTCCTTCCTGTTCCAGCCTTCTG
CTGTTACATCTTTGTTTTAAAACAATATAAATAAAAATATACCTGAGACTAGAGTCACAT
CTTGATACAGCTCTTGTCCTGGTGGGCAAGAGTCCTTGGAGAGAATCTACTGGTCTTGAT
TCACTGGTGTCCCCATTAGTGCCCTGATCCTAAACATGGAATATCTAGCTCCTAAAAGGT
AAGCTTTGTTGGGCATCTTTTAGGGAGCTGGTCTCTGCTTTGTTGGTGTATTATAAATGT
TTTTCTTTGTTCTTCTAGGGTTACTACAAAGTTCTGAGGAAGGGAAAGCTTCCAAAACAG
TCTGTCATCATGAAGGCCAAATTCTTCAGCAGAAGAGCTGAGAAGATTAAGGGCATGGGG
GGAGTCTGTGTTCTGGTGGCTTGAAGCCTTACAGAAAGAAGTTCATTAAATGCTAACATG
CCTAAAAAAAAAAAATTAATAATAATAAGAGAAGCTTTTCAGGTTTAGCTCCAAGCTTGG
AAGTCATCACTCAAGCCTTTACAACAAATAAAAACCGAATAAACCAAAAATCAATAACTT
TTCTTGGACTCATCAGATAAATGGGGTCCCAAGGTAGAGAGAGAAATCCAGAGAGTCCAG
TCCAATATCTGCTTACCTGGAGCTGAAACTACTAGGGCCTTAAACTGTTAGGAGCACTTA
ACTGGTAATTTTGATGAATTGCTGATATCTAAGTATTGATAACCATGATAGTAAGAAGGT
CTTGAGGCCTTAATCTTAGGGGGACCTCACATTTTTGTGGACCACCACCAGGTCCTCATA
GTGACATGGTAAGATATACTCCCTTGTGACTTTGGCAGGGGGAGAGAAATAGTAATCATT
ATGAAATATGCCCAGAGCATTCTCTATAACAAAGACCTTCTTCTCAGGGGAAAGATTTTA
CCAGAGCAAATAACCTGTCTGCAAGAAGGCCATTTCTTCCACTCCAGATAAGAAACACTT
GTAAAGGACACAAGTCCACTAAAAGACTGAGATTTAATCATAATTTGAAAGAACACACTT
CTTCTGCACCTTACCATCACTCTAAAAGGGCTTAAGGATAAAAGAAGTCAATTACAGCTT
TCTGCCTGTGCATACTGCTGAGGAAGTATCAAGGTCCTTCCTCCTTTTGCCATCATGCCT
AAGTCAGAGTCTCCTAAAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved