Dasypus_novemcinctus Locus Mono:410:SNORA62
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:410:SNORA62
Dasypus_novemcinctus
Mono:410:SNORA62
GeneScaffold_4513
SNORA62
1001..1158
2158
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCT
AGGTCATGCAGCAATTCCTAATGGAGTTGGCACAAGAACTCATGTGTTTCAGTACAGTGT
TTCCCCCATTATATTGCGCTATTTCATATTACAGGTGAAAAAGGAGCCCAGAGAAGACCA
TACATCTAGACAGATGTAGCACCAAGTCTGTTTTTCTCTCCTGAAACACAGATACCAAAA
CACTCCAGGTTATTTTGGGAGGTTTGGTGCCACCAGTGTTCAGTCCTGTACTCGAGCTCA
TGAGAGAGAGAAAACCTATTACCACTCCAAAAATTCTATTTAACCTCAAATTAGTTAAAA
TTAGTGACAGCACAAGTTGAAAAAAATTTATAGCATGGGATATGGCTCAAGTGGTTGAGC
ACTTGCTTCCCACATGAGAGGTCCTGGGTTCATTTTCTGGTGCCTCCTAAACAACAACAA
AAACATAAGCTAACTGAAAAAGCTAACTCAGGGGAGCTGATGTGGCTCAGTGGTTGAGAG
CTGGCTTCCAATAGACGTGGTCCTGGGTTCAATCCCTGGCCCCAGGACCTTAAAAAAAGA
ATTACACTATGTATGACCCATTAAAAAAGGGTTCATACTGTTGGTAAAGAGATATTATAA
CCTAAATTCTGAACTGCCTTTTTCAGTGGAGGTTTGGGCTCACAGTATTCTACCATGGTA
TGAAAAGTTGATTTTAACTGGCTGGCTGATGAACTCTCAAAGTGTAGGTAGTGTGCTACA
TGATGGGCAAGCTTTTCAGTAACACCGCAAGGGTCTCTGACACAATGAGTAGAGTTTGAT
AGTAATCCTTGCCACGAGTGTAATTTTAATGTATAAAGCAGCCTTAGGGAAAGACTGAAA
TGTCTGAAAAACAACCAGCAAAGATGTTTCTTGTGTCCTTTTGCCTATCTCCATCTTTCT
TGCTCTGTATTGGCCTCTTAGGGATTCCTTGGTCTTTCTGTTTTCTGACCAACTTGATGA
ATCCTCCTGTACGATGCTTAAAAAAGGGAGCTCACTTGGTGGGTTTGATGTGGTAGACGC
CGGCCTGGGAAGTTCTATGCCTGTGTGGTACTACCTCCTGTGAGCACCCATGGAGGTCAA
GCCTGATCTCTACTTCTACAGAGAGCCTGGAGAGATTGAAAAAGAAGAGCAGGCTGCTGC
TGAACAGGCTGTGACCAAGGAGGAATTTCAAGGTGAACGGACGGCTCCTGCTCCTCAATT
CACTGCTGCTCCACCTGAAGCTGCAGCCTGTCTGTTGTTCCTACTCAGCAGTTCCCTAAA
GACTGGGGCCTCAGGCTGCAACTGGAGACTGGCCTGCAGCTCCACTGCTCTGGCCACCGA
GCAGGTGGAAACCACCAAGTGGTCCTGAGCTGTTCTTCCACATACTCATAAACAGAAAGT
GGAAAATAGGTTGCTGAAAAATAAACATCGGTTTCTTTAAATTTTAAAACTAGTGGACTC
TAACTGCACACCCATGAGTAAGGCTATTATTTTTAAAATGTAAAATAACAGGTGTTGGTA
AGGATGTGGAGAAATTTGAAACCCTTGTTTACTGCTTTGGGAAATATAAAATAGTGCTGC
TGCTGTGAGAAACAGTTTGATGGTTCCTTGAAAAGTTAAACATAAAATTACCATATGACC
CAGAAATCCCACTCCTAAGGTATATAATTTAAAAAATGAAAGCAGGAACTAAAACAGGTC
CTTGTACACTATTCACAACTGTGAAAGGTAGAACCAACCCAAGCATCCGTCAACACCCAT
CGACAGATGACCAGGTAAACTTAATGTGGTTTATACTACAGTGGAGTCAGCAGTAAGAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved