Dasypus_novemcinctus Locus Mono:41:SNORD35
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:41:SNORD35
Dasypus_novemcinctus
Mono:41:SNORD35
scaffold_13945
SNORD35
1001..1087
2087
CAAGTGGAGGTAGAGTTCTAGCCCCAGGCCTGTTTCCCCGGAGCACAAGCCAATTATCT
GTTTTACCTTTGGGGTTTCAGTTTAGATTTCATTTAAATCAAAGATTACATAGTTTAAAA
AAAGAGAGAAGTTTTTAGAGCCCCATGCATTTAGATGAAGCAAGTAAAAACCCAGCACTT
ATTTGCCTTAATTACCTAAATTTGTTAGACCTGAGTCTCCTGGCTAATTTCATACTTCCT
TTGCCTATAGAGACCCTGCTAGGTTTCATAAAATATCTCCTTTATTCACAAAAATTAAAT
TTCATCCATTCAAAATAGTTAAGCACATTATATTACTGGGTCTGCCTGGTGCTCAAAATA
ATGCAGGGCTTATAAAAATATTCATGTATTATTTAGGAGTAATGTGTTTTTTCTTTTTTC
TCTCCATCAATGGTTCTCGCACATTAGCATGCATTAGACTCACCTACAGGGCTTGTTAAA
AAGGCAGATTTTCTTCCATTGCTAGAGTCACAATATTTCTATAGTAGAATACCAGTAAGT
CCACTCTATTGGAGCATTTTGGGGACTTGGAGTTGTCCTCGATGATATTGCAGGGACAGA
TGTAGGACACTATGTATCCTGCCATAACCCACTGAACAGACTGGGAGAGAGTGTATACTA
CAACATAAACTATAATCCATGCAATGCTCCAAAATGTACTCATCAAATGCAATGAATGTA
CCACACTAATGAAGGAAGTTGTTAATGTGGGAGGAGTGGGGGTGTGGGGAGTGGGGTCTA
TAGGAACCTATTATATTTTTTAATGTAACATTTTATGTAATCTATGTATCTTTTAAAAAA
AGAATAAAATTTAAAAAAAATTTAAAAAGCAGATTTTGATTCAGTGGGTCTGGAGTGGGG
GCCTGAAATTTGCATTTCTAATAAGTTTCCAGGAGATGCTGATATTGTTGTTCCAGGAAC
TACTCTATGAAGTCATGTTTTAATTTTAAAAGGAAGCTTGATGCAGATGATGGCTCTTTC
CATGGATAGTCTGGGGATGCCCCTACAGGTGCTGCCAATAATGCCAATGGCTCAGCAGAT
GCCAGGAAGGCTGTACAGGGGGTGGGTGGTCTTTCTGAATTTGGTCTTGACTGAAATGTA
GTTAGTAAATTCCTGCAGGCTTCATGGACAATTGTCACCCACCCCCCAACAATAGGCAGG
GGCTGTATGTCTGAGTCTAGGGCAATGGATTTCCTTATACCTTTGCTTCTCTGCTCCCTG
CTCCCACCACCCCCAATAAAATAATTAAATTAAATTAAATAATATAAAATAAGAGGAAAA
GGAAACTTGAAATGGAGTTGTCAAGGGTGTGGATGTCATAGGTGAAAAGGCTACTTCTGT
AGGTGACGTGCATGCTCAGGCAGCGTTATACCCAAAGGTCAGCTGGCAGACTGAAAGCCC
AAGTAGACAGTCAAGTTTGATGCTCTCATGCTCTCCTTCACGATGATTCCTCTGTGGTTT
CCACTTGTAGACAGAGATGTCTACACCAGAGGAGAGGGTAGGAAATGGGTATTTGTAGCG
ATCATGGAATCAGAGATCTCTTCTACCCAAGTTCCCTCTCCCCTTTTAGACTTCTATGGC
TGCTGCTTGAAATCTCTTGGTACTGCTGGGTTTCTTCGTTGGGCACTGTAGAAGTTTGAT
ATGATTCATGAATTCCAAAAATAGATATTAGATTATGTTTGTAAACTGGACTGTACCTGG
GTGTGATTAAATTATGATTAGGACTTTGATTGGGCCATGTTAGAAGGGTGTTGAGTCCCA
ACACCAAAGGGGTGGGAACTCACAGATAAAGACATGGCAAAAGAAGAAAGTTGGAGTTTT
GATGATGGAGTTTTGAGCTGAAGCCCCAGGAAGTAAGCACACAGAGGAGCTTGGTTGTGA
GGAAAGAGAAGCAAGCCCCAGGAAGAGAGGAACCTTGAGTCTGGAGAGAAGCAAGCCCTG
GGAAGAGAGGAAACCAGGAACCCTGGCAGATATCTGCAGCCATCTTGCTCCAACATATGG
CAAAAGACTTTGGTGAGGGAAATAACTTATGCATTATGGCCTGGTAAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved