Dasypus_novemcinctus Locus Mono:368:SNORA8
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:368:SNORA8
Dasypus_novemcinctus
Mono:368:SNORA8
GeneScaffold_5794
SNORA8
1001..1111
2111
NNNNNNNNNNNNNNNNNNNNNNNNNTATTTAAAGACTGTTGATTCAAGTTGTGAAATTA
CTCTCCTGCGAGACTGTATTTGCTACTGTATAGTCCTTCCAATGAGGTATGAAAGTGCTC
ACCTCAGAAAACTCATGACAGCATGATTACTATTTAAATCTTTGTCAATTTAATTGGCAA
AAAAGTGATTTTATTGCCATTCTTTTGTCAGTAGCCTGTTCATATCTTGTCCCCCCCCCC
CTTTTTTTTTTTACTGTTGGGTTGACTTTTTTCATTTGGATTTCTAAGAATCCCTAATAT
AATCAATATGTTAACTCTTCCCTTATTTATTACAAATATGCAAACTCTAAACATTAGGGT
GCCCCCAGGGCTTAGTCCTTAGATCTCTTCTCTATCCACATTCACTCCTTTCAGGATCCC
TTCTAGTCTCATGGCATGAAATCTCGTTTGTATACTGATGACTCCACTAGAATCTGAGCT
CTATTAAACTACATGGGTGCAGCAGTTTTTTGTCTGTTTTGCTCATTGATATCCCTAGCA
CCTAGAACAGTGCCTGGCACATAGTAAGCATTCAATACACATTTGTTTAATGAATTAAGA
TGGTATTATTATTATTATTATTTTACAGATGAGGAAACAGATTTAGAGGTATTAAAAAAG
TTCTTAGGGAGTGACTGTGGCTCAGTGGTTCAGCACCTGCTTTCCGTGTAAGAGTTCCTG
GGTTCAATCCCTGGTACCTCCTAAAAAAAAATTGTCAAATGTCACGTAGCTAGGAAATGA
TGAGACTGGTATTCAAATCCATGTTCTTAACCTACACTGTACTACTTTCCTTAAATTTTA
GAATTTAAAGAAAATAATGTTTAGAATGTTTTTCTATATGTTTTGTTGAAACCTGCCGCT
TAGTAACTTCCACCATAATACACAGTAGAGCTGGTGTGAAGGAAGAGGAGATTGGGACCA
AATTTTGGGATACCTTATATATCCTCGAGAATTTAGATCCTTGTACTGCATGGTATCTGC
GTTCAGCAGCTTTTTTCAGAAATTCAGTATCTGGCATGGTTCATTTTCTTGGCTTTGTGC
ATGTTAAACCTGGTGTTTCTATTGGTACAGTATTTCCACAAAAAAATAGAAGAAAATAAT
TGAGACTCAATCACACTCTCAAATAGCAAAAATTCATTTTAGGTTTCTGAGGTGTATGTG
GTAGAGATGATTTATAGTTTCTCAACCCCCAACTGGTAAAAATGAATTTTTTGCCTTCTT
TTGACTCTGCCTCTTTGGGGGTCATTCCATTAATATATGGAGATGAAGAACTCAGGGCCT
TTTCTTGACTTCTCACTGCTTTGCAGTCAAAACAACTGCCATCTCCACAGCTAGAACTGT
GTCTGTCAAGTAGGAAAACATGTAAGCCAGCTGGCTAGAGGAGTGTTCTTTCTATTGAAA
GAGGCTGAAGACATGGTAATGAATTCTTGCTCTTTATCTAGCCTCCATGAGACATGCTTC
CTCCCCTAATGTGTCCTTTTCAAACAGATCACAATTTAATCTGTTAACTAATAGCCATTT
TTCCTCACATTTTTCACTGCAGCTGGACTTGAAAGCTTTTTACATTCCTCAGACACACAT
TTTTCTACCCTCTTCTTCCTGCTACAGATGATTAACATCTGTATTAATAGCTGTTCTTAG
GATTATTCTCTTACTATATATATATCTTGATTGAAATTACTATTTTTCTCTCTACAAAAG
CAGTATCATCCAGTTTAGGAAAAAGAAGCCACCTTAAAACACATAAGCNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved