Dasypus_novemcinctus Locus Mono:130:SNORA70
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:130:SNORA70
Dasypus_novemcinctus
Mono:130:SNORA70
scaffold_50699
SNORA70
1001..1132
2132
TCCCCATCCTCGTCCCTGCTGCCCAATAATTCCCCAAATATCCATCATCATAAAATCCA
TGAATTTAACAAATTCATTAGAAGGGCATGCAGCCCTCTAATCTCTACCAGGCATGGCTC
TTATAGAAGAGGACAACACACAAGGTATTAGAGGAGCACAGAATAGGATGGAGCAGTTCA
TGTGATCAAGAAATCACAAAAGGCCCAGAAAGGACAGGCACAGACTCCAGGAAAGCAGGG
TCCCCAATCAAACAAGTCAGATTAAACTCATACCGAAAGAAAGCATCAAATTCTGAATGA
TGGGGGTGCACTGAAGGCATCACCACGGTGCCTTGAGACAAGGACACAAGGGTGCCCACC
CAGTTCTGCCAAGACCTTGGATAAGCTGCTCGTCAACATGTGTCTCAGTTTCCTCCTCCA
TGGAAACAGCATGCTGGACTAGATGAATGATATTTAGCTCCCAAACCTCAGCCCATCCTA
TGTTAGATTTCAAATATGTGACAACATACTCATAATCATTCTCCAAAATAAGGAGAAAGC
ATAGAATTCAAAATAGATGCAATTATTTTACTTTTGGCAATACAGCCAGAGACCTAAGTT
AAAGGCCACAGCACACACAGGGACATAGCATCCCTCATCCCTGACCTATCACCCTTCTAG
AATAGCAGAACAGGAGTACTCAACCCACACCGTGCCTTTCACACTCTGAAACATACCCCT
TTGTAGAGCAATGTCTAACATTACTGAGCACCTACCCTGTACCTAGACTTGTGTTAGAAT
CTTCACATCTATGCTGCCTAATTTCCTCTTAATACTGTAAAGATAGGATTATCATCCAAC
TTTCACGGGTGAGAAAATAGGGTCAGAGGAGCTGTCACTTACCTAAGGTCACACAGCAAA
TCCCAAATGAGAATCCAGATCCACATTATTCCACACGGTGACCTTGACAGAAGGCAGTAG
GGTTGGGAGTATAAGAAATGAGTCAGTAATAAAGGACGTGTCTGCAGCCAATTAAGCCAA
CAGTCCTCCTTTCCCCAGGTGGGGCTGGTGTGCAATGGCTGCCAGCAACAGCCTCCGTGG
TAGCAGATGCAACCTGTCGCTGGCACAGTTTGCCTTAAACCTTGGAGACAGTCCTTTCCT
GTTGACGTTCATGTCTGACCTCGTGCTGCACCCAGTCTAGGCTCCGACAGGTACATGAGC
TGCCTTTTGAAAGCCCCAGGGCACAGTAGCCAGGGTCCACATCAGTCAAATCACTATGTC
CATTTGCACCAACCTTCAAATCAAGGAGCATGTGATTGCTGCCCTACTCAGGGCTCGGCT
CAAGTTCCCTGACCTCCAGAGACCCATAGCTCTAAGAAGTGAGGCTTTACCAAGTTTAAC
ACTGACAAATGGGAAGACGTGGTGGCTGAGAAGCGCCTCACCCTGGGATAGTGATGGGAT
CAAATACATCCTCAATTGCGGCCCCTTGGACAAGCACTGCCAGCACTGCCCTCACCCGAC
TTGTGCTCACCAATAAAGGAACTAATAATGAAGGACGGGTACTGAAGACAAAGCCCAGGG
ACACTGAGCGTTTTATTACCTTGCACCTTCCATAGCATGTTCATTCTCTGTTAGAAACAC
GGCCTGTGAACACTTTGAATGTTTAATTTGCATAAAATGAGTAGAACTTGTATTAGTTCC
TGTCCAAGCCTGTTTGAGGCTGCCTTGTTTTCTCTCAGCTGCTTCCCAGAGCTCTTTGTG
GTCCTCTTCCTTCTAGTCTGCTCATAAAACTGCCTCCCCTGGATTCTGAACCCTGAAAAG
GGCAGCTCCTCATTCCTTTAAGCATGGGATAAAATACTCCAAGCAGCATGCACCCCTCAG
TTTTATTTCAAAGCAGCTATGCAAGAGCCAAGACAGTGTGCTTCAGTTTGGATCCTCTGA
GCACAGACATGAAGATAGAATTAGACATGCAAGAGATTTATTGGGAGAAAAACCTGTAAA
AGATAAAAGGGAGAGAATGCAGGAGTAGACTGGAAAGGGCCTTCAGGCTGTGATGCAGAC
CCAACACCTGGGAAGGGAGAAAGGGAAGGAAGGTAGATGGGGTCGAAGGAGCTGCAGTGT
GTGGAACACCTCTGAGAAGGTCTTGGCAAGGCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved