Dasypus_novemcinctus Locus Poly:2:SNORD116
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Poly:2:SNORD116
Dasypus_novemcinctus
Poly:2:SNORD116
scaffold_21141
SNORD116, SNORD116
1001..1091, 3101..3194
4194
ATTTATCATTTGAAATAGGTTCTGTATTGCTTAGTTAATGGCATTTTATTCTCATTGTT
GTGAACATGCCCATGTCTTGGATGAGGTGCAAAGTCTGTTCAATGGAATTCATGTTTCGT
CCTTTGAGATTCTGGAATTTTGTATCCTGTAGCTGAGATTTGATTTTCTGCTGGTGATTA
CTTTGTGAGCTACTTCATTCATTTCTATGCGTGGCCACAGTCTTTGCTACAACATCGAAG
CTTAATTTACTCTTAGGAAGACTATCAGTTAACTACTGGTGTGCCTTATGTACAGCAGTA
ATGGAAAGGGAAGGTCTGTGTGGCGTGTTTCCAGATCCAAAGTTGGTTGAACTAGACAGA
TTGAGGATTGGAGGTTTTGAGTTCCAGAAACACAATAACATCTTTAGGACCAGTAATTGC
ACAGAAGTAATGTTTTTGTGCCAGCATAAGAATCTTCAGAATAACAAGTATACTTGTATA
ACTGCAATATATCTAAAAGTATATCTAAGTATACACATATGTCCATAGTAAATAGAAGGA
GTTGAAATGTACATGCAAGATGTACATTTATTTTTGTCATTGTCCTCCTGAGTATTGTAG
TCACATTTTCATTAGTTTTCTGTATACATCTTAGGTGAAATTGGCCAGGAATGAATGCCA
AGTGAAGAGAAGACAATATAACAATGTTTGATCACTAACCCAAGATGTAGGAGAATCCCT
GGAAGATCTTTGGCAAAGAGCCTTGAGAATCTTGGACATCTCTCATAGCGATAGGCATTT
TATTTTCCTAACCTACTGATATTCTCCTAACAATAGGTCCACTTCCAGGGTTTTCTTAAT
TGCCATATAACAAATGGTGTGCTGAGATTCAATGCTTCAGTGTTTTTGGTCTCCTCTGTG
ATCAATGACTTGGCACTGATAATCCCATGTGAAGAAATGTTTAAAGACATCTGCTGTCCG
AATGCCATGCCTGGACAATTAAAATTGGGCAGTCTGTGCCTGTATCGATGACGACACCCT
CAATGCATTCCTTGGAAGCTGAACAACACGAGTGAGAACTCTACACTGTCTTATCTCATC
GAGCTGAGGTCCAGCATGTTGCCTCTTTCTTGTGCAATATGTGAGTGACGGACAGTTTCC
ATGTGTTCCCTTTTGTGGTCCCACATAGTGCTTGCACATTTCACATGTCTCCAGCCCTCA
GTACCTAGAAAGATGTGTTTTTCCCATGGCCTGAAACCATGGTCCTTTGAGATGGGGGTT
CTCTGAGGACACGGCCCCCCACATGCATGCAGGATCTGTGTGTTGGTGGGTGTAGAGCTT
ACATCATTGGATGGAAGATGCAAGCTGTTTAATTCTAGGAGAAGGAAAGCAGGTCCAGGG
TATTATATGATAGTATTACTAAGGCCCTGGAATTAGGAATGTTTTCTAGGTGTTATTTTT
CATTTTAGGAAGAAATGTGAGTGCCTACCCAGATGGTGTAAATTGAATGGAACTAGTGTT
ATGGATAGTTCAAAACCTCTTTGGTTTGCTTTTTTCATATCAGAGAGGTCATGTAGTATT
TATCCTTCAATGCCTGGCTTACTGAAAGTCTCCTGATTGCGTTGAAAGGTATCGTATTAG
TCAGCCAAAGGGGTGATGATATAAAATACCAGAAATCAGTTGGGTTTTATAAAGGGTGTT
TATTTGAGGTAGAAGTGTACAGATACCAGGCCATAAAGCATAAGTTACTTCCCTCATCAA
AGTCTATTGCCACATGTTGGAGCAAGATGGTTGCCGATGTCTGCCAGGGTCCAGGATTCC
TGGGTTCCTCTCTTCCCAGGGCTCATTTCTCTCCAGGCTCAGCTCCTCTGTTTTGTCCAC
AAGGCCAGCTGTTGATGATCAGGCAACTGTCTCTATCTCTTTCCCTGGGGCTCGATTCTC
TCTGAGCTCAGTTGCTCTGACCCTCTGTGTGCTTACTTCCCAGGGTCCAGCTCAAAAACT
CCTAACTCCATCCTTTGTTATGTCTTTTATGTGTGCGTCCCCCTTGGTGGGCGGGGACTC
ACCACCTTACTGACGTAGCCCAATCAAAGCCCTAATAATAATTTAATTAAGTGAAAGTGA
AACTTTGGACAGACCAATTTACAAACATAATCCAATGTCTGTTTTTGGAATTCATAAACA
ATATCAAACTGCTACTGGTGTCATAGCATTTTGCTTCAGTATCAACTGCTTAAAAAAATC
ACTCTTTTGTGGGGCTTGTGTAGGAAAGAAGAAACCAGGGAGGAGTGATCATGCCTGCAT
ATTTGTCACCATTATTGGTTCAACACCTAGAGGTTCCATAGAGTTTTGTAGGGTTTTGCA
GTGTGTGGTTGATGAGAAGGCCAATATGGCCAATATCATCATTGAATCCTGGGAATAATG
GACAAATTAATGATTGAAGGCACTCCCTTTATTAGAAAGTATTCTTCGAATATGGGATCA
GAGGAATTGTACAGTTAAAGGAAGGCTTTTGTCATAGGAGGCAGCACTTAAAATTCACAT
ATTCCAATTGGCCCCATTAGCAAACATGGAAACAAGCATACACATTGGCATCATACAGAC
CTGTCGGTATAATACAGCCATAGAGAGAAGATTAAAGACTTGTAGGCATGCTAGGCAAGG
CAGTGGAAAATGGGTTTTGCCCTGGTTGCCTTTGATCATTTGTCCTCTTCTTGACCACCC
ATTTCTTTTATGCTCCCTTCTCAGGTGGGATGCCATTGGATGGAAGCCATGAGGGTGGAA
AGAGTCTGCATTTCTTTTAACAGTAGGAAGTACATGTAAATCCCTGGAAGCACTATGACT
CTGAGTCTTCCATTAAGCTGGTAGGTGGCTCAAGGCAGTAAGGTTTTGTTTTTGTTTTTG
GCTAAATGTCCTTCAAGTCTCCTAAGGAATATATAGACCTACAAGAAAGTGTTTTTTGTC
AAGTCAAAACACCTTTCCCAGTTCCGTTCCTTGAGTGTCTGGCCTCTCTACCTTAATCAG
TGGTATGGTTCTTTATGCTCAGGGGACTAGCATTTTTGCCCTTATGTCCCCTGCACACCC
CAGCCTGCAGGGCAAAGCCTCTAGACTATACTACTGTGCTTGGATCGATGATGACGCCCT
AATCAGCATTCCTTGGAAAAGCTGAACAAAATGAGTAAGAAATCCCTACCGTCTCGTCTC
ATCAAACTGAGGTCCAATATGTTGTCTCTTTCTAAGTTACTCTATGAGTGAGGGGCACAC
ACGTTCTATGAGTTGTCTGCCCTCCTGGCCCAAGCCTTTTCATTGTGGGTGTAAATAGTC
TTCTGGGCACTAGAGCAGGGCTTCTTAACTAGGGTGTCTGTGGATAGATTTCAGGGGGTC
CATGCATTTGAACTGAAAAAAAATCAACTTATTTTCTTTATTTTCTCTGACCTCTAACTG
AAATCTAGCATTTCTTTCATTCATGAATGTATGCAATAAATTACAGTAGGATTCATTTCA
TATTATATTGCAGTTGTTGCTTATCTCAAAGTCACTTATGCTCACCCATACTTCAAAATT
ACAGTGATTGTTAGACCTGATGATAGTTGAGGGTTATAAAACATCTGCCACTATATTCTG
AGAAAGGGTCTGTGGTTTTTACCTTACTGGCAAAGGGGCCCTGTGGTACAAAAAAAGGTT
TAGAACCCCTGCACTAGAGACAGTCAGTTTTACACAATAGCCCTAGTGAAGATATGCCCC
ACTGCTTGGATCCTCAGTGAGGTCTGTCTCCCCAGTCAATAGGCACAGTCAGTGAATTGG
TTGCCTGGGATTTATGAGGTAATTTTACCTGGAGTCTCTACAGGCGTTTGATAACTATGT
AGTCCTCTGTCCATGTATAGGGGTTGGAGACTAGGTTTTTCAGTCACTGAGTAATGCCCT
AGGTCAGGGATTTGGCAGTGATTTCTAAGATTATATCATTTGGTGAGGAATTGGAGTGCC
AGTGGTGTTTGGGTTGAATTAATGGGAATGATTGATGGGGATGCTTACTCATCATCTACA
AGCATTATGAGAACCAGTGGAAAGGTATCATTGCTAGGTACTCTACACTTGACCCTAAAA
TGATATGGAGGTGCTATGGGCATTATTGGCCAGATGAAGTAGGAAGCAGGGACAGTTACT
CTTGAAATGATTAGATGCTTCTAGAAATATTTCGATGACTGGATTTCCCTCATAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved