Dasypus_novemcinctus Locus Mono:369:SNORA29
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:369:SNORA29
Dasypus_novemcinctus
Mono:369:SNORA29
GeneScaffold_5169
SNORA29
1001..1144
2144
GCTAAGCCCCACATGAGCAAAACCAAAAACCTAAGCTAGTTTCTATTTTCTATAAATGC
TTGGCTTGCCCAGAATACCAAATTTAAATCCAGCCAATCAGTTATTGCCAGCAAACTTCC
CCATTCCTAATCAACTACTTGCTTCCCGCTTTGTACATGCCCCCCACCAAGCAAAATGGA
AACTTAGTATAAGCCAGTCAGAACATTTCCTCAACTTGCTTCCACATTTGCCCTTTCCAT
CCCCTCAGTAGAGCTTCCTTCTACTTTCTGAATTGGATGGTGCCTGAGTTGTTGAATAAA
GTTGTGAGATCCTAAATTGCATGAAAATCGTTTTTTTGTTTTTTAAATCAATTTTGATGG
TAAAGATGGGATCCAAGGGCCATGGCTGATGGCTCTGAAGACAATGAGAAAAATAGGTGA
AGGTGTCTTAGAGGCTTTTGGGCTCTCTGTCAGTCATGGATGATTGCCTCTTGGATTCCA
GCTCTACACTCTTGTGCTGCAGTTCTCTAGTCTCATTCGCTTGTAGCCCAGATGTTAGCA
GGTCAATCTTATTGACAAGGCGGCTCAAATTTCAGTCCAAGTCCCTAGCTTTTTGATCAA
TCTACAGTTTTAGTTTGGCTACTGCTGGCTTCTTTGACCTGTGCACAACATAAGTGAAAT
GATAAAGATGGGATATTCAAACTCTTAAAAACATTGATTCTCCACCCTCTGGCACTCTGG
CATATTACATGTTCAAAAATTATAGGGCTACTATACACTTGTTGTTTATGTATGTTTGTG
TATGAATGATATACTTCAATAAAAAAAGAAAAAAATTTTGAAAAAAAAATTATAGGGTTA
TCTAACCAAATAGCAAAATCTCACCATACACAACCTAGAGTTGCAATGGCCATTAAGGTG
AATGTTCCAATTAGACAAAGTTATTCATCTCAGAGGTGCACTCAAGGAAAAGGACTTCTG
AATTAGGCCAAATGGAATACTTACTTTAATTGTACTCAGAGGTTATTAAGAAATTGCACT
CTTACTAATAGATTTTAGTGGCTATGCTTATGGGATAAATAAAAATTGCCATGATCTGAA
AAGGGAGGATTGTGTGTGTGTGTGTGTGTGTCCTCCTCCTATGTGAAATGACTGGACAGA
AAACTCATGCCTATGATGTTTGTATATGTATTAAACTTGATAAAACAAGAAAGAAAAAGA
AAAGAAATTGCAAAACTCTAAAATTACCTTATGTAAACTAATGAGTTTTCCATTTCCATG
TTTTCTGTATTTCTGTATTTTATTTCTGACTCATGGATGAAATTTTTAAGTTGAAGCTAT
ACGCTCTCTATTTGATATATGATATTTTCTTAAGTCTGGATGGTATGGCCAAATTAACTT
ATAAAATTTCTTAAAAAGAGCTCTATTCAAGTCGACTTAAGGATAAATAAAGGAAGCAGA
TTTGGCTCAATGGATAGAGCATCCACCTACCACATGGGAGGTCCAGGGTTCAAACCCAGG
GCCTCCTGACCTGTGTGATGAGCTGGCCCACGCGTAGTGCTGATGCGTGCAAGGAGTGCA
ATGTCACGCAGGGGTGTCCCCCACGTAGGGGAGCCCACATGCAAGGAATGTGCCCTGTGA
GGAAAGCTGCCCAGCGTGAAAAAAGTGCAGCCTGCCCTGGAGTGGCACTGCACACACAGA
GAGCTGACGCAGCAAGATGACACAACAAAAAGACAACACAGATTCCCAGTACCACTGACA
AGAATATAAGCGGACACAGAAGAACACACAGTGAATGGACAGAAAGAGCAGCCAAATGGG
GGGTGGGGGAGGGGGGAAATAAATACAAACAAAATCTTTAAAATGAAGATAAATAAGTGC
TTATATATAAATTAATACTCCTAAAGTCTTAGAAATTAAAGCAACCAAACTTTTAATATT
TCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved