Dasypus_novemcinctus Locus Mono:378:SNORA29
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:378:SNORA29
Dasypus_novemcinctus
Mono:378:SNORA29
GeneScaffold_1416
SNORA29
1001..1143
2143
GCTCAAAGCAAATTTGAGATGGCAGAAAAAAGANNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNCTGAACCCCAGAGAAGCAGGCACTCAACCACTGAATTCACTGGCTC
CCCTGAGTTGGTTTTTTCATTTGTTAGCTTATTGTTTGGGTTTTCTTTTTGTTTATACGA
GGCAACAGGGACCAAACTAGGGCCTCCCATATGGGAAGGAGGCACTCAACTATTGAGCCA
CATATGCGACCAACAATGTCTTATATATTTTTTATAAATGTATTCCGTATGTTGAAGAAG
CTGGAGGAAAGACTATGTTAAATAGACACATGGAAGATTAAAAAGACCCAGAAAAGAAAC
TAGAATGTCTGAGATGAAAAATGCACTGAGTGGGATAAAGGGTAGCTAAGAGAGCAGAAG
CAAAGACTATTGAATTTGAAGACCTAGTATTACAAATGACCCAAAATGAAATTTAAAAAC
AGCCAGAGTAACCTAAAATAAGTGCATTTATTTTGAGGACTCTCAAAGCAATGAATCATA
GGGAGCACTGAGAAAAATATTTGAAGAAATTATGGCTGAAAATTTTCCGAATTTAATGAA
GACTATCAGTTTACAGATCAAGCTCAACAAACCTTAAAGCACAAGAAAACGGGAAAAACA
CACCAAGGCACATCATAATCCAACAGCTTAAAACCAGTAATAAAGAGAAAAATCTTGTAA
GCAGTCAGAAAAAAAAAAGACACATTATTACAGAGGAAAAAAGGAAAGAAGACATCAGAT
TAAATCATAAACAATGGAAGCCAAGAGGCAGTCTTGAAAGCAAAACATCAGAATTCTATA
CGTAATAAAAGTATCATTGAAAAATAAAGACAAAATATTTTTATTCTTAGACATATTAGA
GTTGAAAGAACTTCTCATTAGCAGATGTACAATAAACGTTTTTTCCCATTTGACTACCAC
TTTTTCTCTTAATAATGGATTTTAGTGGCTATGCTTATGGGATAAATGAAAATTGCCAAA
ACCTGAAGAGGGAGGATTTTGTGTGTGTGTCCTCCTCCTATATGAAATGGGTGGTTAGAA
AACTAGTGCCTATGTTTGTACACATATTAAATTTGATAGAACAAGATGTTTGAATACTAA
ATTTGTGTTTCCTCCCCATCCTTTAAAAAAAAATGAGTGTTTAAAGGAATTCCTTCAGAC
AGAAGGAAAATGATACTGCAAAGTAACCTGAATCACACCTAACACATCAATGCATATCAA
ATTATTTTTTTAAAATCTAACATTTCATAAACATATCAACTCAAACATAAAATCTGTGGA
ATGTAACTAAAGCAATATTAAGAGGGAAATTCATAATACGAAAAGGCCTAATTACAGAAG
AAAGGGTCTCAAATCAATGATTTCACCTTTCCTCCTTAAGAAACTAGAAAAAGAAAATAA
ATGAAGCCATAAGTAGAAGGAAATAAAGGTTATAATGGAAATCCATGAGAAATAGAAAAC
AGAAACACAACAGAGAAAAATATCAATGAAACCAAAAGCTGCTGCATTGAGAATATCAAT
ATTATTGATAAATCTCTGGTCAAGATAAAAAGGAGAAAGCTGACATTATGCTGATACCCA
AACCAGAAAAAGGCATTACAATACAACTACAGACCAGCATTCCTCATAAATACAGATGTA
AAAATTCTTAAAATTTTAGCAAATCAAATCTAACAATGTTAAAAAAGATTAATACATCAT
AACCAAGGGCAGTTTGTCTTAGGAAGGTTTATAATTTGAAATCAATGTAATTCACTATAC
CAGCAGAATAAATACATATATAAAATCATTTCAACAGATGCAAAAAAGAAGCATTTGACA
AATCTTCTATCTAAACATTTTACATATGTATACAAATGCACACATATATAAACTCTCTGC
AAAGGAGGACTAGAAAGAAAACTTCTCAAACTAATAAAGGACATCTATGAAAAACCAATG
GGTAATATCATGCTTAATTATGAAAGACTGAATGCTTTTTCCCCTAAGATCTGGAACAAA
ACAAGGATATCCTTTCCTAACACTTCTATTCAACACTGTAGTAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved