Dasypus_novemcinctus Locus Mono:408:SNORD89
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:408:SNORD89
Dasypus_novemcinctus
Mono:408:SNORD89
GeneScaffold_4915
SNORD89
1001..1117
2117
TTGTTTTATCTAACAGACTGCCACAGAGTAGGTTTCCATAACAACTGTTATCTCTGAAA
TCTATATTCTGGGGCCCAAGGTGAATAGGAAATTATGTCCTTGATTCTGTACCAAATAGT
TTGTGTTTGCTCTCTGTATTTTAAGAAAACAAACTGGGAAGGAATGCTTTATCAGTTTTT
CCCAATAACTAATGAAGGTGACTTTTAAAAAGAGTACTGACAGGAAGCAGATGTGCCTTA
AGCAGTTGAGTGTTGAGTGCCTGCTTCCCACATGGGAGGTTCTGGGTTCAGTCCCTGGCC
CTGGTACCTCAAAAAAAAAAAGAATACTGACAGAACAAGGTAAATAATCTTTTATAATTA
CACTACAGAAATGTGATTTTTTGATTAGCAGCTGTCAAACACTAAATCAAACACTATAAA
TGAGAAGAGAGGTTGGCATAATTGTAGTCTTATCTCTAGAAACACAAGTCTTTAATAGCA
AAATAAAAAGATAAGAAAACTCAAATATTTTGAGAGAGAAAAGTTTCCTCATTTTACATG
GAAATAAATGATAAGGGACAAATATTACTAGAATTTTTGCTTAAACTTTAGATAAGATGC
TGAGAAGGGAAATGTAAATGAAGAGTAGAGTAATATCAGTTTTAGTTATTTATTGCAGAA
ATCATTTTCCTGACAATTATCATAAAATTCATTTGATTACAAATGTAGAAAGTTTTGGGT
TTTTTTTTAACTTTGAAAATTTTAAACAGCGGTTTGATAGAGGAAATACACCCATGTATA
TAAAATCCTTTATAGTTATAGCTCACTGCCTGCTGTTGTGCTTATTCACTCCCCAGAGTC
ATCTTGTTTGGCATCTTCTGGATTTCCCACTAGAAGACCACAAAGGTCCAGAAGAGAGGT
GGAAAACATGGAACTATTTGGCAGGTAGTAATTTCTCGCAGGCTGTCTTCGTAGGGATCT
TGACTATAGAAAGCCTGTCTTGAAAGATTGTTCCTATGGTTACTGAGGAATGATGACAAT
AAAAGGCCGAATTGCAGTGCCTCCAAATTGCAGTTTGCTCTCTATATGGATGCACGATGA
CAAAATCTCCTGAAGCGAACCACTGGTCTGACCTCAGTAACATCAGGATTGAAGCTGTGG
GCCTTGGTCAAGCTTTCCAAACAGAAATGGCCAAGAAAGATATTCCCAAGAGAGATGAAA
TAGTCATAATCATAATAATAGTTCTAAAAGAATAGGTGTGTTCCCCTTTGAAATACCCAG
TATAACCAAGTTCTCCAGTAAGACCTTAGCTTGGCAGGAGTCTTTTCCTTTTGGCACATT
AAAGTCCATTGGCTTACTAAGGCTGTGATTCAAACTGATGACTGTATGTGTTACTAACTA
GAATCTGAGGTAATAATATGCTTTAGTCAAAAGGAGTTTCTCATAGGGTTAGTGTGACCC
TTCCTTTGCAATTTGCAAAGCACAGGACGTTGGCTAGAACCCCAGCTTGTTTTGTGGTAT
ATGTTGTGCTACCATGAAGCAACAGCCAGTTAGAAAAGCCATCTATACCTTTCCCAGCTA
ATTTAGTTTTTGTTTAAAAACACTTCTCAGCATTTCATTTTCAAAAAAAAGAAAAAAGAA
AAAAAGAACTAGTACTTAGGTTTACTAGTTATAAAAGTGAAATTTCCATAATATCCTAAT
TGCCCATGCAGCTAAATACTTGCCCTCTTTTATAGCAAAGTATAGAATAAGTTGTCAATT
TAAAGAAGTATCTACACTGCATTTATTTAAAATTAATATTAGAATTTAAAGTTAGTCCCA
GTCCATTCTTTTTGATGAGGTGTAGTGTAGCCTTGTGCATCTTATAAGTTAATAGCAAAC
CTGGGAAGACCAGTACTTCCTGTGGGCTGTTAAACTCGACACCCTTCCAAGCAAAAATAT
AAGTGCGTTAAAGCATCTTAGGGGTTTTCCTGATAAGAACAATAGTAGATTGTATAAATA
GAAAAGAGAGACTAGATATATCATTTTCCATGGAGATATGAATCATTAAAACATACAAAA
CGGCACATGCTGCTTAAAACTGTTAAATATATATGTACACTATAAGAATAAAAATTTATA
GTGATATTTCTGTAAAGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved