Dasypus_novemcinctus Locus Mono:338:SNORA1
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:338:SNORA1
Dasypus_novemcinctus
Mono:338:SNORA1
scaffold_264375
SNORA1
1001..1134
1595
AGAGAGACACAAATTCCCCATGCCACTGACAAGGATAGAAGTAGACACAAAAGAACACA
CAGCAAATGGACACAGAGAAAAGACAACTGGGGTGGGGGGAAGAGGAGAGAAATACATAA
AAATAAGTCTTTAAAGAAAAAAATTATGTACCTCTAAAACGCAGTACATTAATTAAATAT
CTGATGTTCAGCAGAGTACCTATATCTAAATGTGAGCACAGATATAAACAAAAGTTTACC
AATCCAGTGTTGCCTAATATTCTGACTGCTGGCATCATTAATATGGCAGTAAAAGGCATT
AAATTAGTAGATAACATGAACTCAAGTTCCATTAATTAACTGGGTATGTCTTGGACACAT
CATTCATTGCTGTGAGCTGCCAAGACTCATAGCTCATAGGCAATTTCAGGATCGGGCGGT
TATTTCTAGAAGGAAAGAGGACTAAAAGAAAGAAGCTATTATAGTCTTATTCCATATAAG
AATGGGGACAGGGATCATGGTGTCCAGAACTGATAAATGTGGCTAAACTGAGACACAGGT
TATGCTTCCATCACAGTAGATTTATTGCAGTGATGACAATGAGACCTGTAACATTTTTTT
TACTAAGGTCATGCGTTAAAAAATGAATGTAACAAGACTTTTCAATATTATAAACAGATT
AAAGACTAGTACATTTTACATCATTTGCCAAAATACAAATGTACTCCTTCTAGGGGCCTA
AAGTGAATAATTTGAAGAAATTAGGATCCAAGAAATCTCGTAAACAGGTGGGGGATTTCT
GAAGCATACATCAGTGCGTCCACACACAAGTGGAGATGAAAAGAAGCCCATCTAAAAGAA
TTGTTGACAAGGCTGACTGGAAACCATTGTGAATCCTTTTTAAAAGAGCTAGCTTGAAGA
TGAATTTTGTTTCAAGTTTCAGAGGAACTAAGTTGACTGTAATAATTAAACAGTGGAATG
ATCACATGTTGAATTCTGTAAATAAAAAATTTATTAACTTTATAATATACACACAAAAGA
AATATAACCTTTACACTGTAGAAAATCAGAAGGTATTTTTGGCTTAAAGTTTCTCTAGTG
TTTCTGTGGAGGAAATAAAACAAACTTAGCAGCTGAAAGAAAAAAAGAAATGTTGGCAGG
GGTGGCAGGTCCAAGTCTCGTCAGTTTGTCTGGAGGCTTTTCCAGGCATCCTCACTCTGC
CGATTAAACAAACAAAACCACCGTAGTGCAAGTAACCGGAGTCTCCTTTAAGGTTTCTGA
GCACAGGGAGACTGGGTAGCACAGCTACAGAAAGAAACACTTAGCAAAGCTGTTTAGAAA
GGAGTAAAAGAAGATATTGCCCAAAACTTCCTAATTGGAGGGGGGAGAGGGAGGACAAAA
ATAAATCACATTTTTCCTAAGAGACAATTTTGTTACCAACTTGGAAAAGAAATTTAAAAA
AAAAAACTTTATTCAAATTAACATTTGTGTTTATTAAATGGGCCAGAAGAAACAAAGATA
AGTAAAACTCTTTTGTCTCACAGTCTAGTGGGGTGGCAGGCACTGTTTCTCTGTACAGAG
AAGCAAATGGCATACCGGGAGACAAAAGCGGAAGAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved