Dasypus_novemcinctus Locus Mono:19:SNORA27
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:19:SNORA27
Dasypus_novemcinctus
Mono:19:SNORA27
scaffold_7606
SNORA27
1001..1119
2119
CTGAAAACCTCTCTCCTTGCTCACTGAGTTACATAAAGAGGGATAAAACATGAATTCAG
CACCTAACATGTTCTAAAGGTTTTCAGTACCTTTATGTTATATAGTGTCCATGAAAAGAA
ATCTTAGGATACAGAGATTATTTTCATTTTATGAATGAAGATTAGTCTCAAAGTTCTTGT
AATTTTCCCTTAATTCATAAAGCTAGAAAATAACAGAACTGTCTAATTACAACTTTGGTA
GTGCTTTTAAAAACAAAGAATCAGGATCAGTTTGAGAATATTCTAAGGATTCATCAAGTA
TTATAGAAAATCTTGATATGCAGAAGTCTAGAAGACAGAGGAATAGAGATAAAGGAAAAA
ATGATTCTGAAGGGCTATTTTGTTGAAAACCTATTAAGTAAATTCCACAGAAGAATAGAA
TATATAAAACCCTAAACTGCTTCCATATTCTGATTTCTCTGGCAGATAGTGTCAATGCCC
CAAATATCTTTCTATATACCCACAAGGAAAGAGACAACACTATCAACTAACAAGTCCTAA
CATACATCTATAAAACACTCCATCCAACAACATCAGACCATACATTCTTCTCAAGTGGAC
CTGGAACTTTCTCCAGGAAAAGACCATATATTAGGACACAAAGCAAGTTTCAGGAATTTA
AAAAGGAATGAAATCATATAGAGTATGTTCTCTGACCACAACAAAATGAAAATAGAAGTT
AATAATGAAGGGAAATTTAGAAAAATTCACAAATACACAGAAATTAAGTATTACATTCAA
AAATGACTATCAAAGGAGAAATCACAAGGTAAATTAGAAAATAGTTTGGGAAGAATGAAA
ATGAAGACAGATCTCAAAACTTACGGGCTCAGCAGAGCAGGTAAAGCTCAGGGTCTCATA
TAAGGTCCCAGGATCAATCTCCAGAACCTCCTCATGGGTTCAGTGAAAACCACACTGAGG
GAATTTGATTGTTGTACATACCTATATTAAAAAAGATTTCATTCTCACTTTTCACATAGC
CAATTGCACATGTCTTTATTGGTCATTCAAGTGGAGCAAAGGAAACATCGTTTTAAAACT
CAGGTGAACTGTTTGTCTTATATCCTGTCAGGAAACAAACTGAAATTAAAAAACTAAAAG
AACAAAGATTTCAGAGTGATATCATCACTATGGCGATGTAAGACATCCCCTGAAAAATAC
TCCCTAGAGACTTAGTTAGTAAAAGGACAAATCCCATTTGCTTGGAACTTTGGAGGATGA
TAGAGACTAGAGAAAGACTACACAAACACTGTATCAAAACAAAACAAAATTAAAAAAAAA
AAAAAACAGATTAAAACCTAGGTAGAATAATTCTGTCCCAGAACACCAATCTGAACCCAT
TCCCTCTCCCTCACTCAGTCTTGCACACCTTGGAATTCACACAGAAGCAAATGACACAGG
TCCTCCCACTGTGGACAGAAGCTATAGAGCAATATACAGCAGTGAGATAGAACTCCATGC
ATATCAAGGCACAGGGGCCTAAGCCCACCGAAACCCAAGGTAGAAAATAAGCCACAAAGG
TGTGCTACATACAAAAGGTACCTGGTGGTGATAGGGGTGGAGAAGAGAGAGATCATGATT
GAAAGGCTAGTAAGAACTATTGTGCCCTCAGTCAATTTAGTTGGCTAAACCACAGAAAGG
TAAAACAGACCTATCTGAAGTGACCTACCATTCTAGATTGACTCCATCAGGCTCCTCTAT
TTGGGATACCAGAAGTGGAAAAAAATTGGGGGCAGAAAAGCCTCACAGAAAGTAAAAAGG
TACAAAGGTTAAACTGGACTGATGTAAGATAGAATGGATACAGNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved