Dasypus_novemcinctus Locus Mono:301:SNORA25
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:301:SNORA25
Dasypus_novemcinctus
Mono:301:SNORA25
scaffold_192792
SNORA25
1001..1116
2116
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTGGA
TCTTTTTAAGAGGTAGGTAGACAATGGGAAAGACATTTTATAGGTCATTTCAAAGAGGGC
TTGTGGGACTGAAACCAGGAGCTCTTAACGCTGTGACCAAAGATTAAGGTTCTCCACAGG
ACGACAGACACTAGTGCTTTGTTTTTTTCCTGAGAGAGCTACAAGGTATAGCCAATTCAC
TGACGAAACTTCACGTTGGTGATGTGAAAAAGCAATTTTTTCCTAGGGCTATCTTGAAGA
TAAATCTTGTTTCAAGCTTCAGAGGAATTAAGTTGACTTAGATAATTAAACAGTGGAGTG
ATCACATGTTGAATTCCATAAATAAAAAAATTTATTAACTTATAATTTGCTAGACATAAT
AAAAATACTTTTGACACTGTAGAAAAAAATAAAATAAAATAAAATAAATAGCCCTCACTA
TGTCCCAGGCACTGTTTGAAACACTTTAATAATAATGACTCATTCTTTTCTCATAATTAT
AGTATCCACCCCATAGGGTTGCTATTCCCATTCAACAGATGAAAAAAATTCAGGCATATG
CAAGGAGACAGCTCATCGGTAGAGAAACCAAGATTTTAAATTCAGGCAAGCTGGCTCCAG
AGAATAAGCTCCTCGCCGCTGGGCCAAGCTGCTCTCCCAGCTCCCTGAGTTGGGCAGAGG
CCAGTGGCCCGAGCTCAGCTGATCAGATGGCCTGAGATTTCGAAAAGTGACACAAGGATG
CAAGAGCTGGTCAGAGATGATTTGCAGGGCTGCCATGGAGGTAAGCACACAGCACAGCGA
CAGCAGTCATTGGGGTGGTGGAGTGCCCTGGCTTTGTCCTTGGCAGCCTGGTCCAAACCA
GTGTCCGCTGTGTAAACACTCCCTGGGACCCTGCCCTTTTGCTGAGCCTGCGCCCCAACT
CCCACGAATTCTGTGAGTTTCCTGGTTCCCCTCCAATAAGTTATTCTCCTGCTTAAGTGG
TCTGCAGCTCAACACCTGACCAAGCGGGCTCATAATGACAGTTAGGGCTCGCGCAGAGGC
TTTTGGAGAGCCTTCCACCCTCTGAGTCCCTGGGTGGCTGCTGGCACACTTAGCTCCTTG
TGGCACAGCATCAGGGGCAGTGGCTGCCTGGCTCATAGGCACCACCACCTCAGGTCATCC
ACTGTCTGCTGGCAGCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved