Dasypus_novemcinctus Locus Poly:9:SNORD47
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Poly:9:SNORD47
Dasypus_novemcinctus
Poly:9:SNORD47
scaffold_96896
SNORD47, SNORD81
1001..1076, 1221..1297
2297
AATTTTAGCATATAATGAAGTTTTATGACTGAACTAATTATTATTTTGACAGGTGTCAG
ATTATGATGTTCTTATTTTTCTTATTCCATCTATATGCATTAGTTGGTGTTTCCCTAAAG
ACAAATTTTCTCTAATTCCCCTTTATTTACTTATGTATTTATTTATATTATTTTGGACTT
TTAGATTCCTATCTTATTTAATGGGTTATAAGTTATTATTATTATTATCATAAACTAACT
AAAGGCTTATATTGTCTCAGAATTAGATATGATGGACCTTTGAAGCTGCTTCTATGTCCT
TGTGTATACTCCCATCAATCTTAGGGTACATTCTTATTTTCTGGCAATGTAAGATGTTAT
GGGTTCATTTTGCATTTTCCTTGTCCCAGCCCTGGAATCAGTCATTAATCTGCCCTGGTT
CCCTTTAAAAGGAGTGGTATTTAGAAACCAAAGTTTGGGCATAGATTATGTTTATTGCTA
TTTTTTTTTTTTTTTTTAAAGATTTATTTATTTATTTAATTTCCCCCCCCTCCCCTGGGT
TGTCTGTTCTTGGTGTCTATTTTGCTGCGTCTTGGTTCTTTGTCGCTTCTGTTGGTCGTC
AGCGGCATGGGAAAGTGTGGGCGGCTCCATTCCTCGGCAGGCTGCTCCCTCCTTCGAGCT
GGGTGGCTCTCCATTATGAGTGCACTCCTTGCGCGTGGGGCTCCCCTACGCGGGGGACAC
CCGTGTGGCACGGCACTCCTTTGCGCGCATCAGCACTGCGCATGGGCCAGCTCCACACGG
GTCAAGGAGGCCCGGGGCTTGAACCGCAGACCTCCCATGTGGTAGAGGGACGCCCTAACC
ACTGGGCCAAAGTCCATTTCCCTCATCTGATGTTTTTAAAGTGACTTATGAAACTGGGAA
AACTAAATAATAAATTATTTCCCTCTTCAAACAGGTAGATTTCATTTACCTGAAGGCTTC
AAGGTGAGCTAAACTTAAGTAAATATAATAATTTGGAATGTAACCAGTGATGTAATGATT
CTGCCAAATGAAGTAGAATGATATCACTCAAAACCGTTCCATATTGTTTCTGAGGTTACT
TTACTTTAATGAGAGCATAACTGATAATTTTTACTGTGATTTAATGCACATTCTCTGCTT
TTAGGATTTTCATGACAGCCCACCATGCAGCTCTTAATATTTGGAAGGTGAGAATTTAAA
ATATCATCACTGTCCTTGTTCCAGAATACATGATGATCACACCCCAACTTGAACTCTCTC
ACTGATTATGTGATGACGATAAAAGATCTGATATTCTGTGTAGCCCACATAGCATTTTTT
TTCTTATCCCTACATAGCATTTAAATAGAAATCTTAATATGTGATTAAAGTATTTGTATT
TGGATTGTCAGACAGCTGGATTGGATACTCACAATACAAGANNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCTGAAAGCCTAATCTTTTTTA
TTTTTAAAGGAGAAGAATACAAAGTAAAAAAGGAAAGGAAAACATATCTTGATGGACTTG
ATTATATATTTTTTGTCTTATTGGATTCAGAAAGATAAAGAATGTTGAAATTCTTTAGAA
AAACGTGCAAGAAAACATAAGAACCGAAATAAACATTCTCAAAAGAAATCCAGCTGTTTT
ACCTCATATGAATGCCTTTAACAACTGTGATTTGCAATCTCTAAAATGGGGTGAGGATTA
TGTGATTTTTATTCTGAGTAAAGAAGTTAAACCTCCATGTTGGTGTAATAAATGAGTCTT
ATATTGTATCTTATGATG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved