Dasypus_novemcinctus Locus Mono:150:SNORA24
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:150:SNORA24
Dasypus_novemcinctus
Mono:150:SNORA24
scaffold_58558
SNORA24
1001..1132
2132
TAACATTTGTAAAACAGAGTAATTCATTATAGCAATACTTTAGGAGAAAGGCCACATAA
TGCTATCAATTAATATTAAAAAGTATATGATACAATTCAGTAGCCATTTAAATATTTTTT
CATTAATATTTACAGTTTTAATTTTTTTATTATAAGAGCAAGAATTTTGGGTTACAAATT
GAAACAACACATTCTGTAGAAGAAAAGATTCCTTTTTTTAAAAAAAGCAGTTTTATTGAG
ATATATTCACATATCATACAAGCTATCCAAAGTACATAATCAATGGCTTTTAGTATAATC
ACACTGTTTGCATTCATCACCACACAAAAAGTTTTAATAGAACAATTTCATTACTCCACA
AAGAAAAACACCACACCCCTTAGTAGTCACCTCTCAATCCCTATATCCTTCTCTAGCCCT
ACATAACCACTAATCTAATTTCATCTTTAGAAATTGATATATATTTACATTTTATATAAA
TGGAATCATACAATATGTAGTACTTTGTGTCTGGTTTCTTTCACTTACATAATGGTTTTT
TGTCTGATACTAATATCTTGTAACATTAGCACACATATGTTCAGTTTCAAAGAAAAGTAG
TCTTACCATATTATCATATTACCAATATTCATATTTCACATGAGGTTTTACTATGCTATA
CAGTTCCATGTTACATTTTTAAGCCATATTCATATTTCACGTGAGGTTTTACTATGCTGT
AAAATCCCATGTTACATTTTTTAGCTTTCCTTTTAGTAATATACATGACCTTATACTTTC
CCTTTCAGCCACTATATAATAGCACTGCTAGTTACAAACATTGTTATGCTTTCAACTTTT
CTACTCATTTCTAAAGATTAACACACAACCTTTTACCAATTCTGCACAAGTTAACCCTCA
GCTTTCCATTCTCTAACTTCATCCTATTTTCTGGTGACCCATTTTCAAGTTATTAACTCC
ATGAGATTATACAATATATTTAGTTCATAGTAGTACAATCATTCCATGTAACTTTGGGAC
CTGCCATCTGTGGCAGTCTCCCTTCCTGGCCACAGAAGAACATTTTCTTGTTTTATTGGC
AAAGCGGTCACCATTTAATTGGTATCAGATTCTGACTTGCACAAGTAACATTCTTTACCA
TTAAAAACCTGCAGTGTTTTGAGTTACCGGGCAAGCTTTTCTAATTTTCAAATGTTTCTA
GGAAAACTGGACTAATGTTCAGACCGGAGAATATAACAAGATGTCAAGAAATCCACAATG
ATAAAGATGAAGCTTTATTCGGCATCTTGGCAGTGGATCATCAAACTCGAATTTGTATTG
TGTTGGGAATAATTTCTGGAAATTATATAGACCTAAATATTGATTGTTAAATAGAGCATA
GTATTTACATAAAGAATGAAATGGGTGCTTTGTTATAATTGGATAATATGTNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATATGTTTAATTCATCTGGGTGATCATTT
AGGATGATTAATAAGGTGGGAAGGTAAAAAATGAACAGATTGTATTCTTGGCATGGTGGA
AAGTTATAACTTTATTTACAAAAGTATGTGTTGAACACTTAAAAGTTATGACATAATTTG
CTATAATGAAGGCATTATTTCATGAACCATGTTTTCTAGTTAGGATCCAGCAAAGTTCAG
GCCATCCCTTTTCAAAAGTTATCTTGGAACAACTATGCCCATTCATTTACATATAGTTAA
GGTTTGTTTTCTGAAATGGTGTTTGCTGACACCACACAAGTTTGCTGACCCTTGGTTTAT
ATGTTACTTGCACCTGTGCTGTAACTTACTGAAGGCAACCTCAATAAAAAATGCATTTTC
TTGTAAAAAAAAAAAAAGTAGTACAATCATATAGTATTTGTCCTTTTATGTCTGGCTTGC
TTCACTCAACATAATGGCCTCCAGTTTCATCCATGTCATCACATGCTTCACAACTTCATT
TCCTCTTACAGCTGCATACTATTCCATCATGTGTATAAACCACAGTTTATAGATCCATTC
ATCAGTCAATTGACCTCTGGGTTGTTTCCAACT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved