Dasypus_novemcinctus Locus Mono:21:SNORA21
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:21:SNORA21
Dasypus_novemcinctus
Mono:21:SNORA21
scaffold_9363
SNORA21
1001..1135
2135
AATGAGAATTGTTGATGTAAACAAGCTTTCCTTCTTCATTACTAGCTTACCCTGCTTAC
AGAGAAACAACATTTCACATTTGTATTTCTGGGATTCTTTACAAACACTCTGAAATTCTC
TAGGAGGCTGAAGCCCATGGATTGGGAACTATGGGCATAGTGATATTCATATGGGAGTCA
CTATGTTCACTTTCAATTCAACATATAGCTATGGTGGGTCTACAACTTGGACTCTTTATT
AATCCACTTAAGCTCTTTGTGGCAGTTTGATATTGTTTATGAATTCCAAAAATAGATGTT
GGATTATGTTTGTAAACTGGTCTGTTCCTCTGGGCATATCAGATTATATTGGATTTAGAA
GTTTCACTTTTACTTGATTAAATACTGATTACAGTTTTGATTGGGCCACATCAATAGGAC
TAGGATGTTGCATCCCCACCCTTGTGGTGGGCAGGGACTCACAGAGAAAAGACATGCCAG
AAAATGGAGTTTGGGGTTTTGGATGATAGAGCCCCAGGAAGTAAAAACACACAGGAGAAG
AACACGGAGGAATAGAGATGGCTCCATAGATACAGCAGAGACCCCGAGAAGAGAGAGAGC
CTGAAAATCTATAGCTGACCTTGTGGAGAGGTCAGCTATAGATATCGGCCTGCAGGTGAT
ATTGGAAGAAGCTAGGACCATGGAGCCTTAAGGGAATATGAAGCCTGAACCCTTGCAAAT
GCCGTCAGCCATCTTGCTCTAACACACAGCAACAGACTTTGGTGAGAGAAGTCACTTATG
CTTTATGGCCTGATAACAGTAAGCGTGTACCCCAAATAAATACCCTTTTATGAAAACCAA
CAGAGTTCTGGTACCTTGTATCAGCACCCCTTTGGCTGATTGATACACTCTTGAATAATA
AATTTTGTTGGGGTATATTTGAGTAGATTGATACTGGTTCCTGGGAAACAAAATATATCC
TAAACAAAATCACATCACTTCTTGTTCAAAATCATCTACATCCCCTTTTAAAAGCACTCA
GTGGGCCTTTTCCTGATACCCACTGAGTCGTCAAGAAAGGGAAGAATAAAAACATCACTT
TTGTGTGAAGCGGCAGCATCTTACGTTGTTTTGATTCAATCAGTGGTATGACGATGTAAA
AAAAAATATCTACAGACTTACTTAGGGTTCCTCCTTAATTGATAATTGTGGCCTGGTCAT
GTTACAGCACTCTGCAGAACAGGCCAAGCTCATTTCTACCAAAGTGGTTTTATACTCATT
GCTACTTCTACCTGGAACTCTCTTCTCCCTGGTCCTAGAATCACCCCCTCATTCCATCCT
TCTAATATATGTTCAAAGGTAATTTTCTCAGAGAAGACTTCACTAACCTCTCTTTATAAA
ATAACTTTCTTATCAGGCTCTATCCCCTTTACCAAGATCAAAGTACAATTGATCTTGATT
GTGACCTGAAATTATATCTTGATTTGTATGTTGTTTCTGTCTCTTTCCCTCACTATAACA
TACATTTCATGAGGTAAGTACATGTTTTGTTTTTTGCCCACTGTTGTGTAGCTAGAAGTA
GATCAATTCTTAACACTCAGTAGGTGGACATTAAGTCACAGTTGAAGTCATGAATGAATA
GCTGGTCAAATTTTCTGCGTGGTCCCCTCATGTTTCATGGCTGACAGCTGAAGGCCCCTG
CTTTTGTTGATTGAAATGTCTTGCATCATTCTATCACTGCACCTTGACTATGTCTATTAT
TGCACTTACCACATTGTCCTATAATTGTTATATTATTTGTCCTTCTTTTCTAGAAGACTG
CGAGGTCAGGGTTTTTTTCTCACTCATTTGTATATTTTTAGTACATTACATTGCATGATA
TATTGAAGGTACTCAATAAATGTTTTCTGAATGAGCATAGAATAACATCTTTCTCCATTA
AAGCAGAAGTTACACCACTTAGTTTAGTCTACTGATGACATAATACCAGAGTTTAACAAC
AAACAAATTGATATTTTAATTATAAAATACACTGTAATTACCTAGAAGATTATATGTCGG
GAAGACTGGGTGAAAATGACATTGTATCTTGAATCCATGTAATGTAATGAGCAAGCAGTG
TTACCCTAAAATTTCTAAAACGTTTCTACTATTTGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved