Dasypus_novemcinctus Locus Poly:11:SNORD49
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Poly:11:SNORD49
Dasypus_novemcinctus
Poly:11:SNORD49
scaffold_153123
SNORD49, SNORD65
1001..1071, 1867..1937
2636
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNAGCTTTTCTAAAACTTACATACCAAGTCCTTGCATAGTATGCTCCG
GCGCTAGCCTGGAACTGTATTTAAACAGTTTTAAGCAGAAACATACTGAAGCATGTCTCC
AGTGCCCATCTTTTAGACAAGTTTAGTTTAAAGTAATCCAGGGTGTCCCCAATGCCAGTT
GAGCCAGAGGAGTGGTACTGGGAAGAGGTGAGGTGCGTGGCTGCTCTGATGAAAACCATA
ATAGGAAGTGCCGTCAGAAGCGATAACTGACGATAACTATTCTTGGCTGACTGCAGTCAC
CAAGTCCTCCCCTGCTGGCTGGTGCCCAAAAATGTCAGTCTGAACTGTGATCCTTAATTT
ATATACACAGGTTGCAACTCTGAAGGGGGTCCCCAATGTGATCAACCAAGGACTCTGCTA
GGAGCAATACTGTCTGCCACAAGGTAAGCTTTGGTCTGTTGGAGAGGTTACTGCTTGATT
GTGCCCAGCTATTGGTAGAATTACATGAGATGGCTAATTTTGTAGCTCAAGTATTGGGAA
TTTCATTTAATCAGGGTAGCTAGCCTCTGACCTATTGGTAGACTATCCCAGAGATGGTAG
TGGTTCGTAGGGTAGAGTGAAGTCAGAAGTTGCTCCTTTTATACCACCTGGCTGTGAGAT
CTTGTGCAAATTATTTGCCTGAGCTCCAGTTTTCCTTACCCACGAAAAGGAAACTCGGTA
ATTTTAGGTTTGTGAAGCGTAATGAGGTGGCTAGACGGAGAGGCTAACTAGAGCTTAATG
GACCTTGGTGTGGAGAAAGCCTACCTAAGTTCATGAGGACTTGTGTTGGGTGGGTCTGTA
GTTGAGACTCTGTGTGTGATCTAGAAACACCTCTTGTGCTTTGGGCATCTGCTGTATTTC
AGGTGTGCCTTGCTCTCCACTTGCTCAGGTCTCAGAGAAGTGAGTGCTGGAGAATGGTCG
GTCAGGCAGAGATTCCACTGGCAGCAGCCGCTCAGCCCAAGAGATAGAGGTAAGGCTTGC
TCTGGACAGTGGGCACTGGGGGAAAGGGAGCAGCTAGTTTTGTTAAAACATGTGCAGAAA
GGATATCAAATGATGAGATCACCAAAAATAGCTGGAATTACCGGCAGATGGTGTAGTGGT
GAGCATGGTTTTCTGAAGATATCTTTTATCGCCACGAATTGACTGTTGGTGGCAGTAGAA
GGTGAGACTGATACTTAGTTTCTTTGCAGGCTATATCCTCAGGCTGGTCACCTGTCTGTG
ACGGGGGCAGAATTCAACCATCCATTTGGACCATGAGAAATTACACGCCATTGACCATCT
GGACCAGCGTGGCTGGAACAGCTCCACTTGCACTGAGTACCTGGCGGCTGTTCTTACCAA
CACAGCCAAGAGAAGTTTGAAACTTTCTGGGACAGGCATGTTTAGTATCACCCATTAGAT
TCTGTCATTGTTCTTGCCAGACTGCCAAAGAGCTTCTGAAATACGAGGTTTTAAAAAAAT
GTATTTTTAAAGGTAAATACATTTTAGTTGTAAGTAATTTTGAGACAGAACCAAGGTCTT
TAAGCAGGAAACTCTTAGATATACCCATGCAAATGTCCATGACAAATACAATAAAGAATT
GTCTTTGGTATTGATTCTTAAAAATGTATTTTTGAAGAAAAGGTTAAATTTGATTACTGC
TCTGCCTGGTGTTAGCAGTCCAGGTATTTGCAGTTTAGCAGCAACAGGTGGTCTAAGCTG
TTCTCCCCTCCCTGCCTATATTTTGGGGACAAAAATTCCAGATCATTTAAGGCATCCATA
CAATCCCTGCCACTTCCAGGCTGTCACTTTTGCATAGCTTTCCTCTAGCTCTCTACT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved