Dasypus_novemcinctus Locus Mono:69:SNORA27
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:69:SNORA27
Dasypus_novemcinctus
Mono:69:SNORA27
scaffold_24990
SNORA27
1001..1127
2127
TGCTATTTTACTTTGTATAATAGGTTGGGGCTCCCTTGGACATATATATATTCACCTTC
TTTCCTATCTGTAGACTCTCCTAAAACTAATACATTCACTCTATTATTCCCACTATTCCT
GATATTGATAACTGGCAAATGAATACCTTCAGATTTCCATGATTCAGACTGATATTCCTA
AATACTAATTAAAAATATTTGTCTGGATGTATTCAAACAACTCAAAATCAACATGTTAAA
ATTATTTTTCATAATCACTATTCCACAATCTTTGACTACATTCAATTATTTTTTCTCATT
GAAAAACAATAATAGTTAATTGTAGATAATATGGAAATTTAGAAAACTGTATAAGTGAAG
TTTATATCACCTTTATTTTCATCGTCTCCTAGGAATCACTTTCCTCTCCATCTATTTGCA
CATATTGGTTAATATCACCATATGTTGGTATATATCTTACAAAATTAATACAACAAATAG
TTTGAGATAAAAAACATATGTATCTTTAATTTATGTTCAACAGGTCATGAAAGTTTTCTA
AGTCATTTGATAGTGTTTGAAAATATTCTTTAAATGAATGTATAATAACAGTACCTAATA
ACATGCTATGTGGAGAAGATATTACTGGATATGTAGGTGTTCTGTTTTACTTTTACAGGC
TATGCTGCAACAAACATCTTTTACATATGTTATTTTTGCAATCTAATTGTAACTTTACCT
TAGACTCCCCATAGATATATGTGATTAAGTTATGTAAATCTTAAAAGTTCTTCAAATACG
TTATCAAATAACATTTCAGATGATTTTATTAATATAAACTGTCATTCACAAGTGACATCA
AAATTTTAACTTTTCATTATTAAAATTTTCAAATTCTTTACCTAATTTGGAGTAAATAAT
ATAATCGATATTAGTTTTTCATTTGCTATTTTGGCTAGTTAAGTTAAATATTTTATGTTT
ATTTATAATTTACTAGAATTGTAGCTTTAAGTCTTGTCTCATGCTCGCTTTCCACATTGC
CAGTTGGACATATGTCTTTATTGGTCATTCAGTTTGGGCAAAAGAAACAGCCTTTTAAAG
CTCAGGCAAACTAAATGTTTGTCTTGTATCTTTTCAGAGGAATCCAATTTTTAAAAACGA
AAAAGAAAAACTTTTCTATGTATTTTTCACTTTTTAAATTTTCAACTGATACTTTTAATG
ATTCATTGGTTTCATTATATATTCAAAGATATAAGTTTTGGTCCTGATACCTTCTTATTT
TAAAAAAATTCATACTCCTCTTCTTCCCATTAATTATTCATTTCTACATTCTTGCAATAT
TTTCCAAGGTTTCTTTACATCATCATTGACTTGTTTTTCTTCATTATTGCCTCTTGCTAT
TTACTGCCTTAAGTAGAGTTTTCATTTTGTGTTTTCATCATCTTTTCTTATTTTTAGCTG
CTTTATATCCCATTTAGATTTAATATAAACACATTCATATTTAGTCATGAAAATATAATG
TATTTTAATGACTCCAAGCAGTCTACTCTATTACCTCAATTATTTTCAAATTTATGGTTT
CTCTCTGTATCTTCAACAAGAAATCTCATTTTCTTTATGTTGTAGGATTTTTATTAGTCC
AATGTTATAGTGAATTTAACTTTTTTGTTCATCTTTGGATGGGCAGAGGTCTATTTAGGT
GTAGCATTTAATAGCATATAGAAATGAGAAGATGTGACTCAAACAGTTAGCTCCTGCTTT
CTATGTGATATGTCCTGAGCTCACACCCTGGCCCCAGTATGTCAAAAAAAAAAAGGTAAC
ATATAGGGTTCGAGAATACTGATGGCCTCTATCAATACCAATTTGGGTAGTGGCTGCTTC
ATTTCTCAAAGCTTGTATCTGTAGGACAGATTCATATTTACAGATGGCTCTAAATGACAC
ATTTGCACATTCTCTACTTCTTTGGAGGAACATCTATAAGGCAACTCACTCCATTATTTT
CTTACCAACTCAAATCTCCCTCAGGAGTAGGTGACTTGAGTAATGACTAAATTTAAGAGA
AGAAACTGAAGAAGCTTGGATCTACTACTCACTTCACTTTGAAATATGCCTACCTACAGA
GGACACACATTCTATACTGTTCTTGTAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved