Dasypus_novemcinctus Locus Mono:141:SNORA2
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:141:SNORA2
Dasypus_novemcinctus
Mono:141:SNORA2
scaffold_1143
SNORA2
1001..1136
2136
ACGTAAGAGAGCATGAGAGAGAGAACTCAGGCCCAGCATTGCTTTTTAACTGCTAATTA
TTCCACCCCTTTGCTAATGGCAGGGGAGGAGTTCCAGCTGTTCCCCACTTTGATTGCTTA
TTTACCCCATCAATCTCCCAGGAGGGCCCAATGATAAAGTCCTTGGGGAATATCCCGGGC
TTCTCCTGGTTCCGGAGGAAGTCTTCTTCCCAGTGGCAGAATCTTGGGGGAGGGTCTTCC
AGCAGCCATCTTGGGGTTGCTGATGTCCACGTGACTCTGCCAGGTTCCAGATCTATCTAT
TTTTTTTTTTCTGCATACAAGTTTTATTTATTTATTTTTATAATACTTTTTTTAATTAAA
GTTAATAGATCACATAGAACATTACATTAAAAAAATATAAGAGGTTCCCATATAACCCAC
ACCCCACTCCCCCACCCCAATCATTTTTGTAAATTATATTTTTTTGAAAATACATACATC
ACAAAAAAGGTTACATTATAAAAAACATGAGGTACCCGTATACTCCCCATTGCCCCCACC
CCACTTCTCCCACACCAACACCTTTCCCATAAGATCCATCTATTAATTCCCTATCTTATT
AGCCTGCTTCACTAGTCTAGATAATAATCTTTGCTTATATGAATTTCAAGTATCATATTC
CATTCTATGGCTTGCCTGTAGTATGATTTTTTCAAAAATTTAATTTAGTTAAGCATATCA
TTCTTTTCTATTGTGGTTTTTACTTTAGTAGCTCGCTTAATTATTTTTCCAATACAAATT
TCATAAATATATTTTACTATGTTTTCTTCTAATTGTTTGAATGTTTTCTTTTCATGTGTA
TACTTTCATCCATTTGAAATTTATTTTTATTTGATGTGAGTTAGTGATCATATTTACTTT
TTATCCATATGGATAGTTGTCCTCAAATCAATTTTTGAATAGTCTATCATTTCTTCTGAT
CTGGGGTGCCACCTTTCATATACCACGTTCCATTAAAAATGTGGGCCTGCTGAGTCAATT
CCAGTTTGATGGAGCTGTTGGTTTCAAACAGGAGCCAAAAGAAATGTCTTCCTATGGTCT
GTTCCCCATTTCAGAACTTTGGAAATGTTATGGTCAATTCATTAGAAAGAAACATTGAGT
CATTGGTGATAGATGTGCGCTAATATTTATTTGTAGTCTTAATAAAAACCTGGGACTCAA
AAAAAGAAAAAAGATGTGGGTCTGTTTCTGAGCATTTCATTCTATTCTGTCTGTTCTTTA
ATCAACAGTACACCATTTTAAAATTTTCCTAATTATTTTGTAATTTTACTGTCATTGCCT
TCCATTCCTTCCTTAATTCATTTTCTTCATTCTGAAGTACACTTCATAGTTTTCTTGAAG
TGAGAATCAGTGATTAGTAAGGACTCAGTCTGTCTTTTCTTATCCTCATTCTTAAAAATA
TGTAGCCATTTGTAGAATACTTGGTTGACAGTTACTTTTCATTCAGCATTTTCAGGATAT
TATTCCATTATGCCCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved