Dasypus_novemcinctus Locus Mono:268:SNORD88
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:268:SNORD88
Dasypus_novemcinctus
Mono:268:SNORD88
scaffold_148691
SNORD88
1001..1091
2091
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNTAAGGTGTGACACAGGTTGAGTCCCTGCCCCCTGGGTGTGGATGTTATAAATGGACAC
TACTCAAGAAGACACTTGGGAAGAGAGAGAGCTCTGTTGTGTTTCATCCTGGGGACCTGG
GAAGAGATGAGCCATTCACCTGATAGTTTGCTGCTGACCTTGTGAAGAGAACACAGCAGC
TGAGCAACTGTGAAGGCCTGGAAAGAAATGAGTCCTATGCCAGGGACTGATATAGGAAGT
CCTAAGAGACAAGCCCTGTGCCAGTCTACAGCTAAGATCCACAGAGAATCTGGGTCCACA
GAGTCTTAAGAAGAAGAAGAAGCCCAAGAAGGAGAGACCAGGCAGAGATCAGCGACCATC
TTGCTTCAACATGTGGCAACTGACTTTTGTGAGAAAGTCACCTTGAGTTGGACTCTTTAG
GGCCTTTTACCCCAAACAAATACCCTTTATAAAAGCATGTGGCTTTTATAAAGGGTATTT
ATAAAATTTTACCCCAAATAAATACCCTTTATAAAAGTCAACAGCCTCCATGATGTCCAG
CACTGGGCTCCAACTACCCCTAAGGACACTGTGCCCCCTGAGACCTTTGACACCTGGGGG
TCTGAGGGGCCCTGGCTCTGGGGATAGGCTGGACAGAGTAAGCATGGCTGCTCTGCCTCT
CACTGACTTCCCCTCCCAATAAAATAATAATAATAATAATAATAATAAAAGCCAATAGAT
TTCTAGCACTTGCCTCAGCACCCCTTTGGCAGACTAATATAACTGGTGTCCTTATAAGCA
AGGGAAATTCAGCCAGAAGAAGCCAGAAGCCAGCAGAAATCAGAGGAGCAGACCCAAGGA
TAAAGAGACTGCTGTGTGATGGAGGATTCCCAGAACACTACAGACTCCTGGGGAAAGCAA
GCCCTGCCAATACTTTGATGTGGGACTTCTGGACTCCAAAACAGTGACATAATAAATCCC
TGTCGTTTACATCACCCATTGTGTGGTATTTGTCATAGCAACCCTAGGAGACAAAGACAG
AAGGCATTACATTTTCCAAGCTAAATGTATAAAGGATCTAAGTGTTTACTAGCTTTGGAA
TCAGATGGTCTTATGTTCAAGTCCCAGAAGCTCTGTCTCTTACTAATCGTATTACCAGTT
GTTGCTACACAACATATCTGACAAAACTTAGTGGCTTAGGATCAAGGTGACAGAATGAGA
CATGTCAGGGCTCTATCCCCCCACAGAAGCTTTGGGAAAGACATGGCGGAAGCATCTTTC
TAAAAGCTCCAGAAAATAATTAAAGGATTGCAGTAATAGGGCAAGCACCATATCAAGAAA
AAGGCCACTTAAAAGCAGTGGGCATAGAGAGCAGACAGTGAGCGCAAACAACAAGTGTGG
GGGGAATAAATAAATAAAGATAGTATCTTTTTTTAAAAAAGCAGTAGGGGGCAGCGGACT
TGGCCCAGTGGTTAGGGCATCTGTCTACCACATGGGAGGTCCGCGGTTCAAACCCCAGGC
CTCCTTGACCCGTGTGGAGCTGGCCCACGTGCAGTGCTGATGTGCGCAAGGAGTGCCCTG
CCACTCAGGGGTGTCCCCCACGTAGGGGAGCACCACGTGCAAGGAGTGCACC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved