Dasypus_novemcinctus Locus Poly:16:SNORA32
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Poly:16:SNORA32
Dasypus_novemcinctus
Poly:16:SNORA32
GeneScaffold_5567
SNORA40, SNORA18, SNORA8, SNORA1, SNORA32
1001..1129, 1906..2034, 2662..2800, 3013..3143, 4453..4573
5573
GAATAATTTTATCCAGTAGTTTTTCATAGAAATTGACTTATTTTTTGAAAGGCTCGATA
AAGTGCTGGAATAAAAATAATCATTAGTTTCTTGGATACTTGATAATGAGATATCTGGTT
TTTTCAATTCTAATCTTAAGTTATAATTTGTATTGTTAGTAGGATTTGAACAAGTTAATT
TGGACTTTTAAAATATCTGTACTTAGTCTCAAGGTTACTGAAAGTTTTAATTAGTATTAT
ATTTTTATACAGGAGGAGAATTGTTTCATAGTAAGTTCAGAATTACCAAACATGAATGTT
TACATCGAACAAGGTGAAAATAATGAAGCCACTGCTTTGTCTAGGAAAAGAACTTCAAAG
GCCAAAAGACATTGGAAAAAAACATCAGAATGACCTGATATGGAAATAGGAATGTAAGTC
AAACAAGGTAATAGCTTATCAAAGAAAGAACAAATATAAAGATATATAAAGATATGTGGA
TTGTCTGCTGCTGATGAAATTAACCATGAATCTTCAAAGGGGAAAATTTAAAAGCTCAGA
ATAAGATTGTGATTACACAGCTTCATTGTGAGTTTCTCTCACATCTTGTTCTGAATTGTA
AAACATTTAAAGAAATTATATACATTTATATGTATAAGAAATAATCATTTGGTAAAATAT
GCAAGGGAAGGTCCTCCTTTTGCTGATGCTTGTTCAGTTCAGATGGGCCTAGCAGACATC
ACGTTAGCATTCAATGAATGAACTAAGATTTTTAAAATCCAAAGTCAGAGATAAAATTAG
GAGCTAATGACCAGCAAATAACCACTTTCCTTTTAATCCTACCTTTATTCAAACATAACA
TCTTGAGGATGCAGTGGTGAGTACTGTAACTAGTACTGCTGTTCTTCCTAGTTAACTGAG
AGGGTTACTTGCAATTTCAGCAACCTATACTATCAAATACGACTATCATTAGTTTGCCGT
TATATACCTTCACACCCTGCCTTATATATCCATTTTACAATGGCACTTGAGTTTGTTTTT
GTCTGATTTGTAGACAAAGACCAGATAGACAGGTGCAAAGAATAAGTCCTCTTTCGCAAC
CCAGAACTCATTGTTCAGTATGAGTTTTGATACAGATAAGAAGGGACATAAATGATGCCT
AGGAGAACATAAGGTTTGGGGAATTGATAACCATAAACCTTACTTATAGGACTGTAAAAT
AATGGAAAAACATTAGCTCATAGGGAAATCATAGCTATGTCAACTTGTAATTCCATTTTA
ATGTTAACAAAAACATCAAAATGGACCTTTTTTTTCCAGACTTTTCTTGAGGACCTTATG
CTTGGAGTTTTCCAGGTATGTCACATTTCACATGGCTTGAATGTACATTGTTAAATAAAC
CTTTATTGGTTTAATTTTTTAGACATTTGCGAGTACTTTAATGTTTTCCATTTACAACAC
TGGTTTTAGGAAATGAATCTGGTAATACAGTTGTACAAGGGGCCAGCTTCATTTTACATG
AGAGCTCTGGAGAATTCAGAAATAGGGTTCCCAAAGCAGTCTTAAGTACTAATGAGGAAC
TAGAGCAAGAATTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNACGTGGTTTGTGGATTTAGGTTCAGGTCCATTTTGAGCATATGGCTGAGGTCTATCC
CGATGGGGTCTCTGTAGACCCACATCGTTGGAAACGCCTCACAGAGGAATGTTGTGGTTC
AGCTTTACTCACAGAACTATTTATTAGATCTGTGAGAAGGAACTACAAGACAGATATTTG
CTAAAAAGTATGAAAGATCTAATAGTTAATTTTTAAAAAATCCTGTAGGTGCTGGCGTAT
CTCACAGGTCTACTCATCTTGGATGTGGTAACAGGTAAGCTCTGAATGGTGACATTGTAA
TCTTTTAGGGTGTGGTTACAATTCAGATGATGAATTTAACTGTTCAACTGCTGTCTGATA
CAGATGAACGAAAGCTTAATTCTGACAGCTGAATATAGCTAAAAATACATATATTTATTT
AGGTTTCATTTATATAGCAATTTTTGACACTTTGGAGTGTTTCTAAATCTTGTTTGGCAT
TATCTCCCTAGGAGTGAATAAGATAAAGTCGTGATGAGGTAAGTGGGATATTCTAATTAC
TATGAAAACTAGCAAGGATTCAACAGTCTTGAAAATCCTGAGTACAGAATTCTATTACTG
GTTTAAGGATTAAGTATTTTAAGGATAAAGAATGGCAAAAATACTGTATATATAGTTTGT
ATGTGGAATGAAAGAAGAAGCATTCATACTGCATTATACCTTATTCAAGATGATTTTCAC
ATGATTTATCCCGTAAGCAGACTTGGATATTAGTAACACTGCAGATGTTGGGAAGTAGGG
AGAATTAGAGTACAATTATAATTGCACTGCATGGTATCTGCACTCAGCATTTTTTTCCTG
CTGGGGAGTTCAAAAGACAGTGCTATAGAAATTCAGTATCTGGCATCGTTGGTTTTCTTG
GCTTTGTGCATGTTAAACCTGGTATTTCTATTGATACAGTATTTCCGTAGTTTTTTCAGT
ACTGTTCAGATTGGTTATAATCATCAATAAGAATAAATTCTTCAGTTTTTCTAGGTTGTC
CAAAATTTTGAACCATGCAGATCCACCAATTTATTATTCTAAGGTTAGTATTGCTATCAA
AACAGGAGAACCTCATACAGGTAAAGATCCATTTTGCATAATTAAGTAATAAGCTTAAGA
GTAATTTTTATATAGCCTCATTCCTTGAGCATGGGCACAGTTTATCATGGTGTCCAAAAT
TGATAAATGTGGCTAAATTGAGACAGGTTATGCTTCCATCACAGTAAATTTATTGCAGTG
GTGACAATGAGACCTGTAACATTTTTATTTTTTTGCTAAGGTCACAAGTTAAAAAAACGG
ATGTTAGCATTTTAGATCATTTGCCAAAATATGAAAGTACTCTTTCTAGGGACCTAAAGT
GAGTAACTTGAAGAAATCCGGATCCAAGAATTTTAGTAACTTTTTTGGAATTTTCTTTTG
AGAAGTTGTGTGCTTACAATAACGTGGAGTGAATTTCCATACAGCACCCGTCCACCAACA
CCTTAACTTTGATTTGCAACATTTGTTACAGATTATGAAAGAACATGATCAATTACCACT
AACTATGGTCCATAGCATACATTTTGTGTATTTTTTCCTTATTCCCCCTATTATTATGTA
TTGGTATTGTACATTTGTCATAGTTCATTAGAAAATACTCATGAACTATGAACAGTTAAC
TATAGTCCATCTTCCATCACAAGGTTCGCTGTGTTACACAGTCCCATGCCTTGAACATCC
TACCCAGTGTACATTCACTGGCTCTCACTTATATCACAAAATTGTGCAGTCATTCTCTCA
GTAAATTTTTAATGTTTTTCCTTAGTCCAAAAGAAAAGAATCCCATACCCTACCCCATCC
CCATTATTCACCCTTAGCATTGCTATAAATAGGGAAAAACACAATAACTTATGGGGTAGA
GTTAACAGCGATATGGTAATAAAATTGCATCAAAGGAGGTGTATACTAGGTTAAATGATT
AATGTATTCCTTCATGAAGCCATTATAGGTATTTTGCAGGAAAAGCTGTAATAGCATTAG
TTGTAGGTTTTAGTACCAAAGCTGTTGTATTAGCACTACTTAATAGATGTTAAAAATACT
GCCATGTGTTTACTTATCAGTAATATATGATGTTATGATGATGGGCAAAATGTTCAACTG
CTCTGAATGGGCTGAATGAAAGCAGCCTTTCTGAACATCCATCCACATTAAATTAGGCTG
TGTTTTAAAATGTTAGAAAATTTTTTTGAAATTAGCATGTTTCAGAGTAATCATAAAAAC
TCAGTTATGTTGGTTCAGATGTGAATGGAAGTGGAGTTGTTCAGCCTTAATTATAAAAAT
TCCAGAGATTTACTCTAAAACATATGCTTGAAGTTATTTAAGAGAGAAAAATACTGTGAT
AACTTTTCAGTGGATTTTGAGATAACTTGGAACTTTACATATAATCCTCTTTTTTACAGT
AAATAGGTGGGGTGTTTCTGAATGAAGCATACATCAGTTTGTCCACACACAAGTGGAGAT
GAAAAGAAGCCCATCTAAAAGAATTAGGACAAGTAATTGCTCTTACTTTACCAAATTATT
TATCAGAATATGCTGGTCATTACCAAGGCTTTTAGAATGCAGTTTCTGATTTGCTGTGGA
GTTGACCATAAAAAAAACTCTCCACTGGGCTTTCTTTTGCTACCTTGCTAGCCTTCAGCC
TGTTGGGAACATTCTATTTCCTTGTTTTATTTTCAAAACATTGCTTGTATCAGCACTGAT
CGATAGAAATAATGGAAATTACATGCTATTTANNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNAACCACTGGCTAATTTTTTTCTTTTCTAGGCTATCTTGAAGATCTTGTTTCAA
GCTTCAGAGGAATTAAGTTGGTTTTGATAATTAAGCAGTGGAATGACCACATATTCTGTA
AATTAAAGATTTATTAACTTAATTTGCTACACATAATAAAAATACTTTTTACACTGTAGG
AAATCAGAATGCATTTTTGGCTCGAAGTTTCTCTAGTGTTTTCTGTGGAGGAAATAAGAC
ATTTAGCAACTGTTTCAGGCTTGTAATTACATTCGCTCTACATGTAGCTGGACCTCATAC
CTTATGAAATTCTTTTGCCCTTGCTCTATTTTGGGCATAAGCTTCTTGTGTTTTTCTGTC
TTCAGGAAGACACACTCTACTTGCAACCCGCCTCAGGTGACTTACAGGTGAACCTGTGAT
AAGACCATTCAATAAATTCTAAATTATCTCAACTTCCTGTTAAAAAATGAATACATCCAT
TAACTAGAAATTGCTTACCTGGAGAATTTTCAGAAACACGTACTTTATTCTTTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved