Dasypus_novemcinctus Locus Mono:172:SNORA48
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:172:SNORA48
Dasypus_novemcinctus
Mono:172:SNORA48
scaffold_72761
SNORA48
1001..1125
2125
TTTAAGTTAAGGTATGCAGGTAGGAAAAAGAAAAGCAAACAGAAAACGGTCTGTTTTCC
TGACACTTGCTCCCTACTCCCCAGTTGTGTTCCCCTGAGACACTACAGGTACGATTTTCT
TGTGTATTCTTTCTCAGGTAAACATTAAAATTTTAAGGATATATATATAACAATTGCTAT
GGGAAAAATAAGGCAGAGAATGGAGATGGGACTGCAATTTCAAATTGAAACGTCAAGACA
TGCCTGAGAAAGTGGCTTTTGTGCAAAAACCCGGAGGTGGGGTGAGGCATGTGGAAATCC
CCTGTATCTTTTGTGTAATATTTATGTAGTCTAAAGCTTCTTTTCAAATAAAAAACAAAC
TTGCTGGAGGGGAAGGAATGGTCCATGTCTGTCTAAAGCAGTGCATTCCAAGCAGAAAGA
AGAGCAGGTGAGAAGGTCCTGAAGCAGGGAGCGCCCATACTGTTTCAGGAACAAAAGGTG
GAAGAGCGAGAGCAGGAGTGAAAGTCGTTGAAGGTCAGAAAAGGAAGCGGATCAGACTAC
AGAGGGCTTTATAAATCAGTCAAAGGACTTTGGACTTCCCCAAATGAGAAGGCACCGGAG
TGTTCTTGATCATAAATGGTTTTAAATTTATCTGACCTGTGGTTTTATAAACTTCCTCAT
GAGATTAGGGTTGCCTCATTCTTTCTCGCAAAGTATTCCACGAAACAAACGTACCATAGT
TTATGCAGTCGTCCCAACTGACGGGGACATTTGGTCTGTTTCCAGTCTTCTGGACTCGAG
CACTTCAATGTTGCCTCTATTCCAAGAAGGCCGGCTGACAACTTTCCGATTAAAGACTTT
TTTTTTTTATGGTAACCCAACTCAATTCGGCCTTTTAATAATTTTCTCTTTCATCAAAGC
AGGGTTCCGTGCAAACTCACTAGCTCCAGGATTCGCAGCTCAGACAGACCCCCAGCCTGA
AACGCTTTTTCCACTTTAATTAAAAATTCGTTTAGCCTCCCCGATTGGGTAGAGTGGCAC
TTGGTGTGGTGGTGCCCATCTCCTGCCAACGACAGAGCAATCCCTTGTTTACTGCAGCTT
GGCTTTTCTATCATACTTAAGCCTGGTTCGTGCCTAAGACATACGTAAATAGAAGGGGGG
GAAAAAACAAGAACAAAGGAAAAAAGCCGCTTAGATGAGCAACTGGTTAAAGGGGGACAA
AGCTGAGTGGTGTTGCTTCCCGCAAACACTTCGGCAAGGAAGGGACCGGCTAGCTCCGGC
GCCCGCGAATGGAGAGGTGTTGCGGGTGCGGGGAAATCTGGAGCCCGGCCCCGAGAGCCA
CCCCGCCATCCCCAACCAGAGAAGGACTGCAGCGAATTACACGAGAGAGCACCCCTAGTA
TCCCGCGGAGAGTAACCTCCACGAGTTGAAAAGTGCAGTAAACACTGACGCCTGCGCAAT
GGCACCCCGCGCCTGTTCCCTTCCCACGCCCTCCCTCTCGCGCCTGCGCATTAGCTGCCA
CTTCTCGCAGGCCTGAGCTGCTGGGGTCCTTAACTGGCCTTTTCTTGGCGACAAAGATGG
GANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved