Dasypus_novemcinctus Locus Mono:416:SNORA20
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:416:SNORA20
Dasypus_novemcinctus
Mono:416:SNORA20
GeneScaffold_255
SNORA20
1001..1130
2130
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNTTCCCCGAGTAAAGGTGGCATTCATTCTAAATAGTCATGTTTTATGTGTT
GTATCTTATAAATAGGGCTGTTCATTGTACCTAAACTAATTCTAGGCTGAATAGATTGAG
AATTGGAGAGATTGTAGATATTACCAATGCAGGTATGTGTACAGCTTAGAATAAAGAAAT
CAGATTTAGTACTCATCACTTAAAAACGAGGGGGGGAAAAGCTTTGAAGTAAGTATCCTG
TATCACTTGAGTATGTTTTATCTATTTCTCTTCCCCCTTTTGCCTCCACTCTTAAAAAAA
GTCATAGAAGAATTAAATAAAATCATTCTTTAGTAATTACCTCTCCTAGGGCCAGAATAT
TTGCTATTTGCAAGCCACTTGAACGGCTTTACCCTTGGATGACAAATCTTTCTCATATAT
GAGCCTTCTAGCATTGCTGCCTTTGAAGACGTTTCATTTAAATTATTTAGTTTATATGAT
CTTGACATTTATTTGACCTAGAATTCATTTTTGTTTTCTCTTTTTCTTCCAGCCCTTTCC
TCTTCCCATACTCAGCCCTGGCCCCCAGTCAGGAGCAAGTCCTTTTAGTTCTGTCTCCCA
AAAATATCACAACTGTGCTTTCTTCTTCATCTCTACCTTCACGTCTTCTTCTAGGTTGCT
CCGCTCTCTCTGGATTACTCCAATAGCTTTCTAATTGATCTCACTATTTCCTCTCTTGTC
CCTGCAATCAGTTCTCCATGATCTTCAAAAAAATAAATCACCTTTGCATTTATTTGCTGC
TGTTGTCTCTGAGTGATATGAGCAGTTATACGCATGGGATAAAATAATATTGGGCTATTG
TAAATCAAAATGGAGTAACCATTTCATCTCTTCTCCATGGTTTAGACATTGGTAAAATCA
ATCAATCAGTCAGGGGAGCAGATGTATCTCAAATGGTTGAGTGTCTGCTTCCCATGTATG
AAGTCCTGGGTTTGATCCCTGGCATCTCCTAAAAACAGATGAAAAAACCAGCTCTCACTG
GGGAGTGGATGTAGCTCAGTGGTTGAGCACCTACTCTCATGTATGAGGTCCTAGGTTCAA
TCCATGGTACCTCATTAAAAAAATAAAAATGAAGTAAACCAGAGCATATCAATCTTTTGT
TAAGAATCCTGCTTCCTTTGTACTGAGAAAAGATTTCAAACACCTTACTATGGTCTAAAA
GGCTCTTTATAATATGGCCTTTGCCTTCCCCCCAACTTCACACTTCCCTTACTCACTAAG
CTTCAGCCACTCTGGCCTTCAGGTTCCTTGAACATACCTTGAATAGACTAAACTTATTTT
TATTTTCTGCTCTATCCCCAAAACCTAGAACAGTGCCTGGCACATGTAGTTGTGCATAAC
AAAGGTTTATTAACACTGAATGAATGAATGAATGCTTTCTAAAGGAGGTATAAGAAAAAT
GTGCCTTCCCCACCCCCCATATGTATGTATGTATAATAAAAGGAATTTCCATGTGTCTAA
AATGTGAATACTGTTGTAGGCCCTTTATAGTTAATGTGAACCAGTGACTTTGTGGCTGAA
CATCATCTTTTACTTCATGAAGTCATGGCCCCCAGCTTTTTGAATGGTTGGTTTTAGCTG
GAAAATAAAGCGAACAATACATCTGGAAATATTCTGTCGTGTTTTGATCTGAGAAACTCT
AGAGAACCAGCTGCTGATTTGAAAGGCTTTTATTATGATACAGACAGTCTATTGTCTGCA
AAAGCACTGGCTATTACACAGTGGTATATGTGTGCTGCTTTTTCTGAGCTGTTAACTTGA
GAGAAAAACTTGTATTCATTAACTTATGCATGACTTGTATTTCTTGAGAATAGTTTATTG
TGTTATATTCTTCAGCTGATTTACTGTGCAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved