Dasypus_novemcinctus Locus Mono:38:SNORA42
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:38:SNORA42
Dasypus_novemcinctus
Mono:38:SNORA42
scaffold_12750
SNORA42
1001..1133
2133
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTATTTGGTTACC
AGAAACAGCAAACTCAATTAGAAATTTTTACAAATGAGATGTGTCTTGAACAGACGTATA
AAAGGACAGAATCTGGCTGACAGGAAAAAGGTCTTTCAGATGCATGGGTTTAGATTTATG
GCAGGCCCTTCTCCTTGATCTCTCATAGTGTTCCATACTAGAACAAACTAGCCCTGAACC
GTTGCCCGGCCTCCTTGTTCGTAGGCTTCAGCATTGAAAGTGGGTTTCACAGTGTTTTTT
AAAAAAGAAAAAGGAACGAAAAGAAAAGGTCATTCAGGTCATAGCCTTCCCTTGTGTACT
ACTGGAAGCAGGAGAGGCTGAGTGATGTACAAAAGAAGTGATTTTTTTTTTTCCCCAAGG
TTCTGACATAGTATTGGCCAGCCTATCCTTTAACTAAAGCTGAGAAGTATGCAGAGACGA
GTGATCATTCATATCAGAGAAAGCAGAAAAATACAAAAAACCTAATGGAAGGGGCCATTG
GGTTTGTGGCAGAAGAGGTCTCTCTTTTTAACTTTTAAACAACAATTTAAATAGAGTGAC
AGAAAAGGAATCCAGTTTGGGGAAATTAAGGAAATGGTTGATGAAGAAACAAAAGTGGCA
GATTTGTTTGAAGAATTTAGCTTTGAAGGGGAGATGGAATATTTGCTAGGAGGAACAACC
AAGTGTAAATACTGCCTATTAACGTTAGGTAGGCTAATCTGCTAATGAAGACACCAAAAA
GATGGTACAGAAAGAGAGGACTTGGATAAGGTTTTTTCATCTATTTCCACACTGCAAAAT
GTGTATGCCCATAACATTTTTGATCCTGTCTACAAAGTGTCAAACATTAGTAGCTGCAAT
TTGAGTTCTTTGCTGTGTTCTCTGAGGTTCAGCAAGAAGAATAGGACTTTTTAAAAGTAG
GAATATCTGAGGTTAGACTTACATGATCTTGTCAGTTGGAGAGTTTGTGAAGTGGGATAT
ATAATTAGGTAGGTCTCTATACTCTTACTCTCCATAAAAACTTAGGTTGGTGGTTGTATT
AGGATTCTCAAGAAAGACAAACTGACAGGATGTGTATGTAAATATTAAGAGATTTTTTTG
TAGGAATTGAGTCATGCAACCATAGGGATTGGCAAGTCTGAATTCCATAGGTCAGGCCAC
TGCTTGGGAATTGGATGAAGGTTTCAATGAAATCCCCAGGAGAAGCTGTCTGGCTGAAGT
AGATAGAAATTCTTCTTTCTGACTGCTGAAAGAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved