Dasypus_novemcinctus Locus Mono:100:SNORA29
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:100:SNORA29
Dasypus_novemcinctus
Mono:100:SNORA29
scaffold_37042
SNORA29
1001..1140
2140
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATCATACTTACTTTAAATTCTTTTT
CTGATAATTCCCAACATCTCTGCCATGTCTGCATAAAGATTCTGATGATTTTCTTGATGT
TTAGACAGTGTTTTAGCTTTCAGCTTGTGATTTATTGTTGAAACCCAGACATACTGTATC
AGAATAAACTGGAGTAACTCAAAGTAAGTGTGAAGTCTTATGTTTTTCTGGAGAGAGATT
ATCTGTGTTAACTGTTTTCCTGTACCTGTAAGTTTCATCAGACAATTTCTTTTAATATGC
TCATTTTTGTCCTCACTGCTTTCTATGGGTTTCTTTAGAGAATTCTTCTTAAATTTTATC
TGCGTCTTGCAATTATTTTTGTTGTAACCTTCTCCTTATTCCATGAGCTAAAGAGAGAAT
GCTTTACTCACAGTCATGGAAAGAGCATCCATTTCATACATCTCCTATAAATAGAATCAG
ACTTCTGGCTTGGGAGTGACAGCAGGTAACTCATGTGATGGAATCTATCTGTGTGAATGT
ACATATATACATATTATACAGGTGCATTGTCAGTGAGCAGTAATATTTTGATAGCTATCT
TTTCCTCTGAGAAGTAGGCCTCAATAGTGGACTAAAATGACTCAGGAAACCATGCTGTAA
ACAGTTGTGTTGTCATCCAGTCTTTGTTTTTCCATCTATAGCGCACAGACAGAGTAGTTT
GGTATAATTCTTAGGGCTCAAGAAATTTTGGAACAGTAATTGAACATGGGCTTCAAATAA
AAATCATCTGCTATTTTTACTCTTAACAAGAAAGATAGTTTTTTCCCAGGTGACTACCAA
TTCTTCTCTTAATAATAGATTTTAGTGGCTATTTTTATGGGATAAATGAAAATTGCCATC
ATCTGAAGAGGGAGGATTTTGTATGTGTGTACAGCCATATGAAATGATTGGACAGAAAAC
TAGTGCCTATGACATTTGTACACACATTAAATTTGATGAAACAAGATGTCTGAATAGGAA
AGTTGTGTTTAAAATAAAGGGAGAGAGAGACAGTCTGTCCTTTGCAACTGTGAAGCCTGC
CATTGCCTTCTCTCTGGCTATGAAAGTCACAGCTGGCATCTTCTTCCAATATAAACTAAC
TAAATATTGATCAAATTTTGGCTTGTGTTAGGATGTATTTAAAGATACATGAATTCATAT
ACTCATCCTATGTAAAGATAATTTTCTTTTGTTTTTCTTTACTTGTGAAAACACTGTAAT
ACTTTAACAACGACAAGAATTCTATCATACTCATTTTCTCATATTTGTATTTTTCTTTGG
TAAATGAGCAACCTTTTCCAAATTGTTATTTAAAAAATAGTTTTGTTGAAAATTATATTT
CTAGGTTTATTTTCAAAGTGCTTTGATGTAAACATTAAATATGACTTAGTGACTTACAAA
TATATTCTTTCTAAAATTATGTATTTACTGAATAGTTAGGATAGAGAACTAAGCATAAAC
AGGGTTATATTTGCATATGATAATTAATTGGAGTGAACCATTTAGAAAATTCTGATATCT
CATATATCACAATCAAACCTCCTATAAAAAGAATCAATATTCAGTCTTTGGAATGAGTGA
AGTTAGTTCATGTGATGTCAGCTCTGTGTATATATATGTATACATATTGTACATTTGCTT
TTAAATTTCCTTTTTCTCCTCTTAAATACTTTACAAGGATCTCACTATATAATACTTTTC
TTCACAATTTAAAAAGCTATTTTTTAATGTAATTTTAATATAATGTTTTAATCTAAGGAA
AACATTAAATATTATAATACATTATTGTATGGATATATTAAGGCAACTATCAATTCACTC
TCTCCTTACATAGCTTATATAATATTTTTCATTCCAATCACAGAATATGATAAAGGATGT
TTGCTTTGAAGACTTTTTTCTCATCATTATTTGAGACTTTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved