Dasypus_novemcinctus Locus Poly:0:SNORD113
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Poly:0:SNORD113
Dasypus_novemcinctus
Poly:0:SNORD113
scaffold_12458
SNORD113, SNORD113, SNORD113
1001..1074, 2096..2174, 3002..3077
4077
ACAGACTTGAGATGTTCCAGGAGCTTGTTCTTGGCTATTTGTGATGCTAAGTATTATTA
TCATTAGTAAATTGATGGATTAATCAGTAAACAAATATAATACAAATACAGAAGTGAGAG
CCAGTTCTGGACCAATGATGATGACCAATTATACCCCTCTACCTAAGGAGCCTATTGATA
ATGATAAAAGTCAGTGTTAACTGTTTTGGGTCAGTCTTAAGAGTATGGTTGTTAGTGCAA
AGGAAAAAAAATATATGAAGAGGGTGAAACATTGCACAACACTGAATATGTATTGAAGCA
AGAAATATTATTAATGAAAATCAAAAACTCTGATTCCTCTTAAGAAATAGATGGATCAAG
AATGTTACCTCTTTGGCTAGTAGATGCATTCAGGCCTAAAAATTGTAGTCAATCTTATTA
CTCTAGGTCAATCTCAATGTTGAGGATGTTTGTTTTATCATAAAGCATTAATTATTACCT
AAACTACTGAGTCACTGAAATACTGAAAGCAAGTATCTGTGGAAAGATGTATGAGTTTAA
AAAAATTATCTGCTTTGCTTTGTACTCTTTAGAATGGATTCACCCAAGCTGATTATAATC
ATTCTGCCATGGCCGTGAATTCTATGTTTGCCCCTGTGTTAGGAACGTGGAGACAAGATG
GGTCAGAGTTAACGTCTAATGTTGGTTTCATGTGTGTTTTTTCAAGCCTCTTCTCTCTGT
TTAAGAAAAGTATGAAATATAATCACAGATTGCCAACCATCCTTTATGATAAATAAGAGG
AATGATATGAAAGATTTTGTTGATTGATTCATAAATGATGGCCTGAAGTTTTGCTTTTAG
GTAAGTTGATGTGGCCGGTGATTATATAGAAAGACGTAGGATATTTAAGGTTCTCTTTCT
TGTATTTTGTAAATTCTAGGGTAATTTTATTATTATTAGTGAATTTACAGATTAACATAT
GAACAAATGGGGATATGATTGAAGCAAAAGAGGGTCAACCCTTGACCAATGATGACGACG
GGTGGCGTATGAGACCTCAGTGATGAATGTATGTATCTGGAACTCTGAGGTCACACACAA
AGAGAGACCTAGTCTCGTCCCCCTTTTTGAAATAATCCTGTGGATGCATGGTAGGAATAT
GAGAGGATCTTGTTCCTTACTTGTGGATCATGGATTTCAAAATTTATTATTATATATTGN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATATTCAAT
CTTACAGCCTCAAGTTTCAGGTTGTTTGTTTTCTTAAGAGAAATACATATATATATATAA
ATGAAAAATTAATACCTCAATGAGTGAGTAAATTAAATAATTAAAGAAGGATCCATGGAG
AGAATACCTGGTTTTTAAATTTTCCAATTTTTTTACCATTGGCTCTGCTCTGTAGCCTCA
GAATTGTTGCCCTGGAGCTGGTTGGAACATTCCTCCGTGGGAACAACCTCCATGGGTGCC
TCTGTGTCTTGGAGCATGGACGCCAATGTGAGTACTGGTCAAAGTTCTTGTCTGGGCTGG
CATGGTATTTTAGGCTGTTCATTATGTATCAAAAAGTTGTAAGTGTAATTCAAAAAGGTT
GACCATGGCCTAATGATTAATTTGGGGTTGTAATGGAACAATATGTTGATTTATTGATAT
TTTCAACAACTTAGAAATAAGGAAATTAGTATAGTCATTGTGGCCAATAATTCTATAGAC
AGATGTCCGGGCTACTTATTGTGTTTTTGGGATTCATTGGTATTATCTTATTGATAGCAT
TGGTTGATGAATTAATCAATTAATGTCGATATGAGTGAAGAAAAGAGGTACCAGCCTGGA
CCAGTGCAGTGATCACGACTGGTGGCGTCTGAGTCACAGATGAGGAATGCACGTGTCTGG
AACTCTGAGGTCCAACACGAAAGGAAATCAGTCCCTTCCTTATGTTGGAAATGAGGAATA
TAAAAGCACCTTATTATCTGGAGACGTGGATTTCGATTTTATTTTTATAATGTTTCAATG
ATAGAACCATGAAGCAAATATTTAAATCAATAAATAGGAGGAGGGTGAAGCATTTTATGA
TTATGAATATATGTGTTGAGATGAGAAACTCTCAATGCAAACAGTCCTGTTTCTTAAGAA
ATAAAGGGGTGAAGGGTGTTACCTCTTCGTCGAAGGATTTTACAGATCCTGATTAGAATC
AGTCAATTTTATTGCTCTTGGTCAGCAGAAATTAAAGGTTGTTCATTTTCTTATATATGT
TTTGTGTATGTGTGTTATATGTACTATATAAATACATATTTTTGTGGATATATTGTATAT
AACGAAGCATTAATGTGGAATGATTGAGTAAATGAAATGGGAACAGGAAGGATTTAAAGA
GAGAGGGTCTGAGTTTTCTTATTATTTGCTCTGCTTATTACTCCTTAGAGTGGACACCTT
CGAGCTCACTGCACCATCCTTCCATGCTCGTGACGCGGTGGACACCCCTATGGCTTAGGG
GTCCTGGGACCAATGTGAGTGATAAGCGAACTCGGCCCTTCTTGTTATTGGATGTGTATT
GCATTATTGAATGTGTGAAAGAAGGCCAACCATTGCCCAGTGGTCCATATGGGATTGATA
GGAAGTATTATTCAAGGCTCTTGTTCTCGCTTTTGAGATTCATAGGAATTTATTTTTTAT
CAGTGAATTTATGAATTAATGAGTAAACAAAGGTAGATGTGAATGAAGAACAGGGCAAAT
CCTGGACCAATGATGATGTCTGGTGGCGTATGAGTCAAAGGATGGTGAATGATACGTGTC
TGGAAGTCTGAGGTCCAACAGGAAAGGAAATTTCTAGTCCCTCTGTTGGAAATTATCCTT
TAGAAAGATATTAAGAATATCCAAGGATCTTACTCATATTTGTGCAATGGATTTTGATTC
TATGACTATAAAACATAAGCAAAGAAATCAATCCCTAAATATAAATAAATAAATTGGGAT
AGGTTTAAGCATTGAACAATTATGAAAACATGGAGCATTAGTATATATTGAGAACACTGA
ATTCCGTTAAGAAACAAACAAATATTTCAAGCATATATTCTTTTTTTTTTTTTTCCCTTT
TTTCGTTTTTTCTTTTTTTTTTTTTTAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved