Dasypus_novemcinctus Locus Mono:274:SNORA62
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:274:SNORA62
Dasypus_novemcinctus
Mono:274:SNORA62
scaffold_154721
SNORA62
1001..1155
2155
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNTTCTATGAGACAAGAACAACAATGCAATAGTTCTCTTACAGAATTAAAA
AAAAAAAAAACTTAATGCACTCACACAGAACTATTTACAGACAAAAATTAAGTTATCTGG
ATTTGCTTCAAAATAATTCTGGAGTGAGCAGAGTCTGGGTATGGATAAAACTGAAACTGG
ATTAGCTAGAAGTCGATAATTTACTGGAACTGAATAATGGATACATGTGTATTTGTTATA
TTATTCTACTTACTTTGAAATGTTAGAAATATTGCATAAAAGTCAGCATGATCATTTGAG
CAATTTCTATTCTTTCAAATTATAAACTACATCATCTCTTAGTAGGGTAAAAATATGTAA
AACAAAGGAAAGGGTAGTATCTCAGGGAACTGAGCATTCCACCCACCCAAAGACTGTTTG
CTAATCACCTAACAATTATTCTTTTCACTCTTCTCTCTTAAAAAGACTTATAATTTTTAC
CCAGGGAGAGCTAAAGATTTTGGCCAATTAAGACAGGAGTCAAAGTATTATGTGGGACCT
CAAGCAAGCCTCCTTAAAAAAGGAAGGAGTGACCTTCTGAGTGTCAGAAATGTGCTAGAT
CAATGGCAGGATTTTCGCTGATGCCAGTAGAGCTTGCCTCCATGACTGGAGTTGGGTAGT
ACTCACTGTCACAAACACTCAAAAAACAAAAACAAAAACAAAAAAGGGAAGGAGGTCAAC
TATTTTCTTCCCCTTTTTCATCTTTTTGCTTTGAGTGCAGATAGGATGGCTGAGCTAATG
GCAGCCATTATGCATTACCAGCATGAGTGGAGACCTGGAAGAAGCCTGGAAGATGACTAA
GTAAGAGAAATCAAATATTTAAACCACCCCCCCACACAAAAATATTTTGTTTAAGCAACT
GATATTTAGGTTTTCCTTTTTATATCTCCTAATTGATATACTTTTTTTCTTTTTTCATTA
TCAGTGCTGTCCAACTGTGCATTCTGTGATAATGGAAATGTTCTATATCTGCTCTGACCA
GTATGGTAGCCACTAGTTACTCATGGCTATTCAGATCCTGAAACATGGCTAGTGGCTACT
GTATTGAACAGTGCAGTAGATGGTTTAATGCCTCTAAAGTAGGGGTTCTTAACAAGGGGT
CTGTGAGCTTGAAATGATATTCAAAATTATGCCAATTCTAGTGGAGACCTATTGGTGCGG
GTCTGATATATTTATTAAATAATACACAGTATAATGTGGACTTAGGGGTCCATGGAACAA
AAAAGGTTAAGAACTCCTGCTCTAAGGGTTATAAACTGTTGTAAAGCTCTCACCTGTAAT
GCAGTTGATTTGGCATAAACAATTTCTTCATCAACACCCACGGATACAACAATGGCATCA
ACGCTAGCATACTCATCCTCTCCTTTCTAAAAAGTAAAAAGCAGGTAATTTGGTCACTTT
ATTTTCACAATGGCAAATAAGAATGCCGACTTCAGTATTTACCCATGTATGAAGTAATTT
TGTTCTAATAGAAGTTTCAAGTTATTGTATATGTTTTCTTGGCATCCTCAGTCATTAGTT
ACTTTATTATATTTTTTCTTCAAAACAAAAGAAAACAGCTTTATTGAGATAATTCACCAT
ACAATTCACTCATTTAAAGGGTACAATTCAATGGTTTTTAATATATTGAGTTGTGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved