Dasypus_novemcinctus Locus Mono:380:SNORA21
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:380:SNORA21
Dasypus_novemcinctus
Mono:380:SNORA21
GeneScaffold_1395
SNORA21
1001..1135
2135
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAATGCAATTTATAAAAGTT
TTTTTTTTTCAGTTTCTTCTGGAAGAAAGCCACCTACCTCTCTATATATTATATACATAT
ATAAATGTTTGACATTAAGAAATCGACATAAGCACAATTTCTAAATTACCAATACAACAG
CCTAGGTAAACAGAACTAGTTGCTTAAGCTTTCCTATATATAATTTTGCATGTTCTCCCC
CGCCAGACTTACAGTTCACTTACTCTTGATGGGAGCACAATGACTGGCATTTTCATCAAC
ATTGTCTTTTACCCAGCAAACTAAAACTGTCTGCCAGTATCTTAAGATTACTAATTTTTC
CATGTGTTTATAAGAGAATTTAACATTGCAAAAATCTGTTAAAATTATGATTAAATCATC
ATAATACAATGTTATTAACTGGGAAATACCATGCTGTCTGGTGTCAAGGCTCTGCAGTTT
AACTTAATAACTCTCAAATCCCTATATTTAAAAGCAATTATTTTACATTTTTATTCTTAA
TAACTATGTTCGTGAAGTCATTAAATTTGGGTACAGCCCATATTAGAATCTCCCTCAAAA
TCTGTCTCAGTCATAAAGTTACAGTCTTTTTCCTTTTTCATAATTACGATATCTTTAAAA
ACTCTGCTATGACAAAGGCAGCCAGTAGAGGGACTACAAGTTAACTTTTGCCATCAGCAG
AATAAACTCAAGTTTTACTCAGACCAGTGTTTTTTTGGCCCAAATACAGCCATATCACAG
AAAATATTATGCCAAGTATAACATTCTGCCTCTAGAGTTGAAACTTATAATTTTTTATTT
ACTAATAGGAACCTTTTTGTCATTTAGAAAAGTCTCAAGAGTTTTGTCATAAAGAAAATA
AAAATTTTCACTTAAAAAAATCTTAAAAAAAAAGGGTTTCCTATTATAGTTGAGTATTAT
CATGTTGTAAAGTAATTAAGACATAAAATCTCAATAACGTTCCCCTTTTAAAAGCACTCA
GTGGGCCTTTTCCTGGTGACTCACTGAGCTGTCAAGACAAAGCAGCATATAAACATCGCT
TTTGGGTAAGCGGCAGCATCTTGTGTTGTTTTGCTTCAATCGGTGGTATGACAAGGTGTT
TAAAAAAAATCTCTTAACAAGAAAGTATAATTAATTAGAGCTTACCCACGGAAGCTAATT
TTACAAAGAAAAGGCTTCTAAAAAGGTTAAAGCAAATAATTTTCCAAAGAAGAGTTTTGA
AAATGTAAAAACAAGGTAATTCCGCCCAAATACAAACTGACCTCGTTCTCACAGAATTAT
TTTCGTTTTACCGAAGACATTAAAGACATGGAGGGAGAGAGGCAGGGATCTGACATGCCC
TTAAGCAGGTCACAGCTATCACCTGTGGAAGTGGAAGCCAGCCCTGGGCATTCCCCAAGG
ACCAGCACACCACTCTCCAGCAGGTGGGGTGGCCCCTGGGACAAATCCTTAAGGACAGCA
TGGGCGCTCCCTGCACCACAGTTTTCCCCCGTCCTAAGGCTTCTATTAAAGGGGGAAATG
TGCTCTCTTGTGACAGCCATCTGCAGTTAATCCATACCTATTACTGTCTGGCTGTTTTGC
TAGATTCCAGGAAAGACATCTGAAGTTATGGCAAATACTAATCAGCAAATGAGATGTTAC
AATGTATATTTCTAAGCCAAAGCATACCACCAAGCAAAAAAAGAATGCGTTTTTTTTTTC
CATTCTAAAACAGCCTTTTCAAGGGTGACCCTTTTAACAATAATGTTGAAAGATGGAGAG
ATGGTTCTTATGTATATACTCGACAATACTTCACAGGACTACTGTTAGAAATTTTGTGAT
GATTAAACTGGTAGAGTAAATGATTGTTAGGTTCATTTATTTACATCTTTGTAGAAACTA
CCCAGACAAGTAAAAATATGGAAAAAAAAATGAAGTCTGCATTATCTAGAGTACTACTTT
CCTCTAGCACTATGGATAAAAAAGGTCATAATATACATTCCTCTAAAATAGCAGAAACCA
TATCATATTCATTTAGAAACTGACACTGGCTTTGAAATTTGTTAAAATTCATATTCTATA
AAGCAAATATTAAAATATGGAAAACATTAAATATAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved