Dasypus_novemcinctus Locus Mono:17:SNORA67
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:17:SNORA67
Dasypus_novemcinctus
Mono:17:SNORA67
scaffold_7471
SNORA67
1001..1142
2142
CCAGTTCAGTGGTTGGAGAGACTGATTCCTCGAGCTTCCTACTTTACCATCTTTCCACA
GTCCTCCTGGACTGAGCTGCTTTTTTTTTCTTTTCTTTTTTTAAATCAATTTTATTGATA
CATATTAATAAACATAGAATTCGTTCAAAGTATACCATCAGTGGTATTTGCCATAGTCAC
AATGTTGTGCATTCATCACTTCAATCATAAGAGCATTTTCATTATTTCAATAATAACGAT
AATAATAATAAACAAGAAAATTCCTCACCTCTCAATCTCTCTGTGCTTCCCCCACTGTAC
ATAGCTGCTGTTTCTGGTTATTCTATCCAAAGTGTATAATTGGCTTTTAGTATAATCACA
GTGTTGTACCTTTATCATCTCAAAAATTTTAGAACAATTTCATTACTCCAAAAAGACTCC
ACACCCCTTAGTATTTCTTTCTCAGACGTACATAACCACTAATTTACTTCCATCTTTATA
AATTGATTTATATTTACATTTTATAAGTGAAATTATACAGTATGTAGTACTCTGGTCTCC
TTCACTTAGTATAATTTTTTTTCTGATATTAACATTTTGTACTATTAACTTATATTCAGC
TTCGAAAAAAAATGGCCTTATATATGTAGTTCTACCCATATTCATATTTCACATAACTTT
AGTTGATAATAGGGCAATCATACAGTATTTGTCCTTTTGTGTCTGGCTTGCTTCACTCAA
CATAGCATCCTCCAGGTTCATCCATGTTATCATATGTTTCATGACTTCATTACTTCTTAC
CGCGGCATAATATTCCATTGTGTGAATACTCCACAATTTGTTTATCCATTCATCAGTTGA
TGGACATCTGGGTTGTTTCCAGCTTTTGGCTATTGTGAGTAATGCTGCTGTGAACATTGG
TGTGCAGATAACTGTTCGTGTTACTGCGACTGAGTTTCTTGATCCCTCATAATTTTTTGT
GGCACAGTGCCTTACACTTAAGCACTCAAAAAATGCTTGTTGTCCAAGGTGATTCCCTCT
CCAAGGGGCCACCTAATGCCCCTCTCAGGAAAGTAGCAATGTGGAATAAAATCTGGCAAG
CCCAAGGTTTTCCGATAGAGAGGGCATGTTTTTCCTTTTGCCTTCCTTTGGCTGCCTACA
TACCTAAGTCCCATTTGGATAGACTGTGGCTTCTCGTCTACATGCTGAAGTTGTCATCTT
TCTTGACACAGGCCAGAGGCATTGATGTGCAGCACATTTCTTTAGTCATTAACTATAATC
TTCCTACCAACAGGGAAAGCTATATACACAGAATTGGTCGTGATGGATGTTTTGGCTGTA
AGGGTGTCTATTAACATGGTGACAGAAGAAGACAAGAGGACTCTTCAAGACATTGAGACC
TTCTACAGCACCTCCATTGAGGAGATGCCCCTGAATGTTGCTGACCTCATCTGAGGGACC
CCAACCAGGAGTCATTCCTGGGGGGCTGAGGAGGAGCAGGAGGGGGGAGGGAAGGGAGCC
AGGGGATGGACATCTTGTCATTTTTTTTCCTTTTTTTCTTTTCTTTGAATAAATGTCACT
TTTTGAGGCAAAAAAAAAAATGCTTGTTAAAGTGAACTGAATTCTAAGGCCTCTCCAAAA
TATATTTCGTATGTAAGTCAAATAGACATCAGGGCTATAATGAATGTTTGCTTATCCCTA
GCATAATGAAGGAATTCAGCATGAGTTTTAGCTTTTATTTAATAAATTGTTTAGTTTACT
CATTTTTGGCTGAAGCTTTTATGATGACAAGATCTGGATTCATGTGGCTAAACAACTTCT
GAGCATTTCCAACCTGAATCGTGGTTTACATGGGTGTACTTACCAAGCTGTAAACAGTTC
TAGACATCATTTAAAACTCCATGAGTCAGCCTTTCTTGTCCAGATTTTTCTTACGTTTAA
CAACCATCTGAAAAATAAACTTGATTTTGTATGTCCATTCTAAATCCCGAAATNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved