Dasypus_novemcinctus Locus Mono:259:SNORA42
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:259:SNORA42
Dasypus_novemcinctus
Mono:259:SNORA42
scaffold_137309
SNORA42
1001..1134
1830
ACTTTGACATCATATTTTAAAGATGGTAAATCCATAAATATTAAGTTGATTGTAATCAA
GTGCCAAAATGTGTAGTAGGGTTGTGGCCAATTTAGGTTAGATTATTCAGGTAAGAATTC
ATGGAAGAGAAAAATGGGTCTTAAAGGGTGGATGGTGGGATTTGATTAAAGGAATTATGG
CTGGCCTGTGCTAGCTAAAGTGGGAAGTAGTTGACAAGTATTAGTTTCTATGTTCACAAA
TATACTATAGCTTAGTACACAGAGAATAGCTTCCTCAGTCTACTTGTTAAATATATAGTT
GTCTGCGTATGAATCATCCGGGGATCTTGTTAAAATGGTTTGTGATTTAGTGTGTCTGGG
GTGAAGCCTTAGGTGCTGCATTTCTAACAAGCTCACCGATGAATGCCTGTGCATCCACAC
ACCACATTTGAAGTAACAATAATCTAGTCTTGGGTAAGTGGTTGAGTTAGATGACCTTTA
CGACACACTTTAATATTGCCATTCTAAGAGAACTGTTGAAATAGAAGGACCCAAATTCTA
GTTTTTTACTCTAATTCGGTCACTTGCTAGCCTTGTGACCTTGGGCTAGTTAGTTAACTT
ATCTCTGAGCTGCAGTTCTTTTCTCTGTTCAAGGGTTGGATAAAGGTGAGGGCTCTGGGA
AACTGAAATAGTACAATTTAAAAATCACGCATTAGATGCATGGGTTTGGATTTATGGCAG
GTCCGTCCCCTCTGGACTTTCTCTTAGTGTCCCATGCAAGAGCAAACTGTTGCCGCAAAC
AGTAACCTGGTCTTGTTCAGAGGCTTCAGTATTGAAGCGGGTTTGCACATGTAAAAAAGA
AATAAAAAAAAGAAAAAAAAAGTCACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved