Dasypus_novemcinctus Locus Mono:116:SNORA42
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:116:SNORA42
Dasypus_novemcinctus
Mono:116:SNORA42
scaffold_41914
SNORA42
1001..1132
2132
ATTTTCTTTTTTTTAGAATTACTTTAACATTTCTTTTTCTTCCCTTCCCCCTCCCCCAC
CCTGCTGTTTTTGTTATCTGTGTCCATTCACTGTATGATCTTCTGTATCTATTTCTCTTT
TTGTCTTTTCTTCTTATCTTTTTCCTCTAGGATTCCTGGGATTTGATCTTGGGGACCTCT
GATGAGGAGAGAGGTTCCCTGTCAATTGCACCATCTCAGTTCCTAGTCTCTGCTGCGCTT
CACCTTGACTCTCCCCTTGTCTCTCTTTTGGTGAGTCATCATCTTGCTGCATGACTCACT
CATGTGGGCCCTGGCTCACCACGTGGGCACTCGTGCGGGCGCTGGCTCACCTCGCGGGCA
CTGGCTTGCCATGAGGGCACTGGCTTGCCATGCGGGCACTGGCTCGTCACACAGTCACGC
TTTCTCTTCTTCTTTTTCACCAGGAGGTCCCAGGGACTGAACCCAGGTCCTCCCGTATGG
TATGGGGAGGCCCCATCACTTGAGCCACATCCGCTTTCCTGCCCACAGTCTTGATAGGGA
AGCAATGACAAAGAAAGACAACTATAACATGGTGGCATAAATGTTACAAAAGGAGTAAAC
CCGATTTCGGGGAGAGAAGGAGGGGATGTATTCGGGGGTACCCTGGGTAGTTCAGGGTGA
AGATGAGAAAATGGCAAGAGGGGAGATGAGAGTGGCAGGTTAGGGGTCAACCTCGAATAT
TCTCAAAGAGCAATTTCTATGTGCCAGGCACGGGGCTAAGTGCTTTCTCTAAGTTTTCTT
ATTTCATCCATATCATAATCTACTGGTCCTCTCTGGGGAGGGGCAGGGCTGACGTGGGAT
CACGTGGCAATGCCTAGACGTCTGTGGTTGTTGCGACTGGTGTGTGTTGGGTGCTGCCAG
CAGGGAGTGTGTGCAGCCCAGGTATGCTGCTAAATATCTCACACAGCTCCCTGGGTTCAA
GAGTTAACTGGCCCAAAATGCCAAGAGTGCAGCAGTGAATGGCACGGGTTTGGATTTACG
GCAGTCCCATCCCCCTGGACAGCTCATAGCGTCCCACTCCAGAGCAAACTGTAGCCCCGA
AGCACTGCCTGGCCTTGTCCGTAGGCCAGGGCACTGAAGCAGGTTGCACAGTGTTAAAAG
AAAAAAAGCTATGATTATGTTGGTAAACTGGTCTGTTGCTCTGGGCATGATACCCTTTGA
CTGTATTAGATTCAGCTGAGGGAAGAGGCCGCGGCTCAACTGATAGAGCGTCTGCCTACC
ATATGGAGGGTCCAGGGTTCGATCCCCAGGGCCTCCTGACCCATGTGGCCCCTGCTCAGT
GCTGCTGCCCTGCTCAAGGAGTTCCGTGCCATGCAGGCGTGTCCCCCACGTAGGGGAGCC
CCACGTGCAAGGAGTGCACCCCTCAAGGAGAGCCACCCCGCATGACAGAAGCGCAGACTG
CCCAGGAGTGGCGCCGCACACAAGGAGAGCTGATGCAGCAAGATGACGCAACAGAAAAGA
GAGGCAGATTCCCAGTGCTGCAGGATAATGCAAGTAGATGCAGAACACACAGCGAATGGA
CACAGAGAGTGGATAACTGGGTGGGGGGGGAGGGGAGAGGAATAAATTTTTTTAAAAATT
TAAAAAAAGAAATGACTTCCATTTTAAAAAAAAAGATTCAGCTGAGATGGCTTTGATTAA
ATTATGTAAATATTCGGGCTTTGATTCAGCCATGCCATTAGGGCATGCAGCTTGAGTCCC
CGCCCCTCTTGGTAGGACGATAAAACAGACTCTTACACGGAAATAGAGACACAGAGAGGT
AGACACGCAGAGAAGATACACAGAGCATCCTGCAGCCCCTCAGAGAGGTGAGCCTGATAG
TTTACAGCTGACCTTGTGAAGAGACCAGAGCAGCTGAGCCCAGAGAGAAATCCCCTCTAT
GAAAGCCACCAGATTTCTGGTCCTTTGCATCAGCACGCCTTTGGCTGGCCAATACCTGCT
CCTAGGAGTAACTTTCCTGAGATTTAGAGTCTAACCCACCTGCATTCGTCCCCAGAGTTC
AGTGTTTTAACTCAGTCATTCCCTGAGCAGCTGTACCTGTAACCATTAGTCTCACAATGG
TTTAGCCCCAGAGAAGCCACTGAAGGGTCTAAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved