Dasypus_novemcinctus Locus Poly:5:SNORD50
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Poly:5:SNORD50
Dasypus_novemcinctus
Poly:5:SNORD50
scaffold_27483
SNORD50, SNORD50
1001..1068, 1281..1350
2350
GTGCGCGCTCCCGCTCCCTCCCCTCTGAAGTCGGCCCCGCCCCCGCCCCGTCTACGTCC
AATAGTTGCTAAAGGGAGGGGCGACTTCGTTCTGACGCGCCACAGGCTATATAAGGGCCT
GCTGGCTTGCCAGTTCGGTCTTTTACGTCCGGATTTGAAAGTTGGTACTCGGCGTAAATA
TATATAGGTGAGTGGGTGTCGTGGGCGGAAAACCGAAAGGGGGACGGTGGCTTCGTGTGG
CCTGGTACTTTGCTGTACTATGAGGCGATTTTAGAGGTTTGCTCTTCGAGTGGTATATGT
TGAAAGTTCACGTGGCGAACTCCAGTTCAGATCACCAAGGGACTCAAGTTTGAGTCGTGG
CTGCAGTGTTAAGAGTTTAGCCTTGAGGAGGCCGCAGATCTACCTCGGGCCCCGCGCGTG
CGACATGGGGCTCGAGCAGCCAGATAAGCCAGCCAGCAATGCGAAAAGAAATGATTTGCG
GGCTTCGTTGAGAGCAGTGAATAGTTTTAATACTGAAAATCTTGAAATGAGACCTTTTGA
GAATGCATAATTTTTAAATACCGTTTCTCCGCAGGCACAATGGCCCTATCTACCAATGCA
ATGCCGAAGCTGTTATGTGGAGATACTAAGGTTAGATTTTAACGGGCTATTGAGCGTTTT
TGTTTTTATTAAAAGAGGAAACCTGTTGGTTTTTCAGAATAGAAAATGGTGCATCTTTTG
AAATGTGCTTCAATTTGTAGCTGCAAAACAAATTTGCAGAATACTGGAGGATATTTGATG
AAAATTAGTAAAGACGTGACATTTTTGAAAGATATGTGTTAAAGTTCTACATTTGAGCAT
ATTTGTAATCCAAACATAAACTAAATGATTTTTTTTTGTTTGAAACAGCATCCCTGGGGT
TGATTGAAGTCTAATGAGGATATTGATGTTCCTAAAGAGCAGCCTCGTTTTGAAGTAAGT
ATTTCAATACTGTAGGATTTCTATATAGACATGATTGGTCTGCTCAATGATGTAACTATC
CCGAAACTGAACACCTGAAGAAAACAAGTACGGATTCGGCTTCTGAGATAAGACCAATGT
TAAACGAAAAATTTGTTGGAGCTCTTAAAAGAATTCTCCTACCTTGTAAATCATCTTGGG
GAGGACTACTAGCTCACAATATTTACTTTTCTGCCAACAGTGAGGCATAGCTGTCTTTTG
AGAGGCCAATTGGCTATGAAGTTCCTTCCTGAGGTAAGCATTTCTCTGAAGATTTTGTTT
TCTTAGGAATTAATGTCCTTTTATCTGTGATGATCCTATCCCGAACCTGAATTTCTGTTG
AAAAAAGTTATACGGATCTGGCTTCTGAGATAGATAACAAGGGCAATGCTTTTTAAATTC
TTTAAATTGTGATGTTGACTGCCGTGGTAACTCTCAAATGTTATATCTTTTCTAGGGCTC
ATGTCGTGAGGTTATTTTTGAAAAGCTGGCAACGAAAATCAACCAGAAAAAGCCCTTCGT
TTTACAGGCATGAGAGGAAACATACACTTGTGATCTGTTTTAGTAANNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved