Dasypus_novemcinctus Locus Mono:33:SNORA68
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:33:SNORA68
Dasypus_novemcinctus
Mono:33:SNORA68
scaffold_11788
SNORA68
1001..1120
2120
TACAGGATTCATTTACCCCTACTATCCTCCAGGAGGTAAAGCAAACAACAATCCGGAAG
AAAATATTCCCGGAAAATGTACAATAACGAGACTAAGAACATTCTTTTGCCTTTTAATTC
ATGTAGAGATAGTATATGAATGCTGGGGAAGTAGTCCATTATCAGTTACTGGGGACCATG
CAGGAGAGAATTAGGGTCAAGGAAGTCTAACATTTGATGGTTTGTCTGTTTTTTAATTTA
CTTCTCCCTGTGCACATTTGTAAATATGAAATTAAAGTATTTTATAAAGAATTTAATTTT
TAAGCTTTTTACCTAACTTGTTTAGTAATTCCAGTTAATCGGTAAATGACATGCTCTATC
TGGGTTTAATAATATTCTAACGAGGTTAACGTATGAAGTTAGCTCAGTATTACCGTTGCT
CAGAGGCCTCTGTGCCTCATGCTTCAGGAATTTATAATCATTGATGTTTTCAGCATTTTC
AATCAATTCAGTCATGAGTTTTATCAGAGTAGACAGCATGAAATGAATTTTCTATGAGTT
TATGGATGCCACTCATAGATGAGTAACATTGGAAGGCCAAGTTGGTGTCTGATGTTTAAT
TTCTGCTTTTTATTTAAATAGGCAAATCCCTTTGAACATTGTTTTGAAATCTCAAAAAGA
GTTGCTGTCCTAAATTTAGAGCAATATGTTTACTCTCAATAGAGAACTCTTATTTAGCAG
TCTTCACTATTTTAAATTATTTACACAAGTTTTGTGATAGCAATTAGCTATTATGCAATT
TATATTTATCTCAATAGTATGTTGCTTGAGTTCAGTACCAAGCTGGAAATGATTTCATTA
ACTCTGTAACACTCGGAAAGATAATTAATTTTTAAGAGTAATGTATCAGTTTGGGTTATA
AATTTTAGAATATTGAAATAAGATACTGCATTAAAATTCAAATATATTCAGCAGATAAAA
AACCCTGTTAAATAGTTTTATTCTGTTAACTTTGCAAGTAACTCACATGCAAACCCAAGA
ATTGCAGTTGCTCTAAACAGTGGTGCTAAGAGGCGGCGAAGGTCGTCACCTTTTGGGGCT
TGTGCTGTGCCCTCCAGAGTGAACGTGGATGTCCTACACCCCGGGGAGACACTGAGCAGG
GGGAAGAGTTCAAGGGCAGCGCAGGCTGGAGCCCCGCGGGACTCCAAGGTCAAGCTCTGC
CCTTGAGGCTCCAGCATGAGCTGCACTTCACCCCCAGCACATCTTCTAAGGACCGACCCC
AGTAAACCCCCTAAATAATAATAATTATAATGAAAGTAAATCAATAAATTGGCAGTAAGC
ACCATATGTGAAGAACGCATAATGGAACCTACTTCTCCCAAATGCTGAGATACAAGATTG
TCAAAAAAAAGAAAGACACACCTTATGATTTCTTTTACCTTTAGCCACTCACATAAAACA
TTCATGACAATTATTGATTGAATGGATTCAGATTCAAATTATTTGTGGTAATAAACCTGC
AAAGAAAACAGATTTTGTTTTTATTCCTAGTTTTGATTTTGCAAGGGCTGGGGGTATGGG
CTTGGGGTCTTGAGTGTGAGCAAGCAGTCTTTATAAGTTTGTGGTGAGGTGGGCAGCTAG
GTCACTGGGCATAATTCCTGGAAGTGGTCCAGCAATTTTATTTCCTAGTCCACTTGGTCT
GAGGGACTGGGAAATATAAAATAATAAAATACAGAATTGAAAAATAAACAGTTGCTTTTT
GTTGTAGTACAATGTAGGTCCCTTCCCTGTTATGCAACATTTACTTTGGTCTCTGGAAGT
GAATCACTGCAAAGTCTGCAGAAGCACAAATTTCTACCAATCCAGTTAAACTGCTACTAC
CTGGTAAGAAAACATTTTTAGAGAAAAACCCAATAGCTTAAGGCACATCATCTGCCGAAG
GATTCCACAGATGAAGCTTGAACAAGTTCTAATGTGTTTCCTCAAAAGACATGGAGCAAC
ATACTGATATTCTCTGTATATTCACTGCTTTTTCCTTGCTTCATGCTCATCTGTCCTGGC
TTTATGATGGATTTTTAAATTCTGGGAAGATCAGCCAACTTATTTTATTTCTAGAGTGAA
AAATATATGTGTGATAAAGGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved