Dasypus_novemcinctus Locus Mono:383:SNORA26
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:383:SNORA26
Dasypus_novemcinctus
Mono:383:SNORA26
GeneScaffold_1819
SNORA26
1001..1118
2118
CCCGACCCAGCTTCCCCGGGACTCGGAAAAGGACGCGCAGCTCAGGGTCACGTAGCAAT
CCAGCTGCAGCAGGGGCCAAGGGCAACCCGCGCGACAACGGCAAGGCCGGGCGCGGCCGT
CTCCCCGCCCCGGGCCTGCCCGGCGATTGGCCATCCCCTCCCCGAGCCCTCCTCCCCGCC
TCCACCCCGCCCCGCGTCCTCCACGATTGGCCGCTGCGCCCACGACCCCCTCCCGCCCGC
ACTACCCCGGCCCGCGCCGCCCTCCCGGCCCTTCTGTCGCGCACCCGCCGGCCTGCCGGG
TCCCTGGAGCCGCGGTGAGTGCGCTCGGCCTCGGCCCGCGCGCGGGGAGGGCGCCCGGCG
GCCTGCGGGCCCGGGTGGGGCTGGGCCCCGCGTCCCCTCCAGCTTTGCCCGCCCCGAGCT
CCGCTGCTCCCGGCGGCCAGAACGGAGGGGTAGAGCAGCCCTCGGCGGCCCGGGGGGCGG
GCGGCCGTGTCCGTCCCGGGGCCGCGGAGGCACAGGCGCCGCGAAGCCGCCCCGAGGGAT
TCCCGCGGGCAGGGCCCGGCCCGGTAACAAGTTTGCGCTTTTGCTTCTCCAGGGCCGACC
CGAGGCTACCTTGTGGCAGGTTCGGGGCCGGGCCCTGCCCCGGGGGGCGAGAGCCGGTCC
GGGGCCGACCTCGGGCCCGGGAGTTCGTTCAGACGTCCGCGGAGGTGCAGCGGCCTCAGC
TCTGCGCGCAGGTGAGTCCCGGGCCCTGCGCCCCGGGAAGTGGCCCAGGCCCCGAGCACG
TGGCCGGCGGCGGCGGGAGGGCCCCAGGCGCGGCTGTGCACGGGCCCGAATCCCGTTCTT
CTTAGCGAAAAGGAAGTTCTAAATAAAACACGACCCAGCCAACGAAAAGGCGGTTTCTGA
TGCGTTTTCTCAATTGTTAAACGAACTGCAGAGATCCACGGAGCAGCGTAGGAAATAGTG
CAACTAGAAAACTGCACAGACATCTCAAACTGCCCTTTCCTGTGCCCTTTTAAGGTTGAC
TCAGTGCTTTAAGAAGCTAACACAGAAGGGAAAAGTCTCCATAAAATGCAGAGAGGAGAT
TGTAAAACTCCCCTTTGGATCCTGTCTGGAATCATAGCTGAACCAGAACACATTTTGTTA
CAGTTTAAGCATTTGCCTTGTGACTTTTTTTCTTAAAAAAAAAGAAGGGGGGGGGGGTCA
CTTCATACCCCCCTCCCTACTCCTCCACCATTGGAACTATATCTGTTCTGTGCCTTGTGA
TATTTTTATACAGCAGGCAGCATAAATGAATTCAAANNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNCTTGAGAAAGTTGAAGGGGATACTCCGCTAAAAAGGTCATTTTA
GGGTAGCAGGTCTTGCTCAGTGATTGAGCACATGCTTTGAATGTACAAGGCCCCAGGTTC
AACCACAGTACCTTTTGAAAAAAAGGCCATTTAAAAAGCCTTTTTTTTTTTTTTAATAGG
ATGAAGACTAGAGGATCAGACCATTCAAACTGGAACGATCAGATGTTGGTAATTTGACTT
AAAAAACAAAACAAAAAACATGACTACAGTTAGGACAGTGCTTATGGTGACAGTATTTTA
GTGGATGCTTTGCATGCATCTTATTAATTTTCACAACCCTGAGCACATACTATTCTCCCA
CATTACAGATGAAGACAATTTAGGTAGTGACTTGCTCAAGATCCCATCACATATGAGGAG
CTCTGAATAGGAGACTTAATGTGTAGTATCTTGGCTCTTGGACCTCCAGAAAGTCACTTA
TCTCTTGAGACTTGGTATACTGATATACAATTTAAAAATGAAACCACACTTAAACACGTT
GAACAAATTTGAGGAGACAGACCACCATAGAGCTGTTCAGAATATAAGCTCTTTATATAT
AAAATTGGACTGAATCTGGAGATTTTGCAAAACTTGGCACAAAAGAAGCAGCTCTGTCAG
CATGTTAAGTGGTTTTTGATGTGTGTAGTAGCAAGTCTCCCAGCCGGAGCTTTGATATTA
GCCTGTAATAGCCTGATAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved